EMAIL THIS PAGE TO A FRIEND

C18orf25

chromosome 18 open reading frame 25

269 Gene Product Result for
Synonyms: ARKL1
Species: Human C18orf25(147339)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145055 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145055 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145055 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU097621 MISSION® esiRNA esiRNA human C18orf25 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001008239 Rosetta Predictions human pricing
NM_145055 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008239 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00027166 predicted 1390
2 SASI_Hs01_00027167 predicted 583
3 SASI_Hs01_00027170 predicted 511
4 SASI_Hs02_00305394 predicted 1394
5 SASI_Hs02_00305395 predicted 1384
6 SASI_Hs02_00305396 predicted 521
7 SASI_Hs02_00305397 predicted 867
8 SASI_Hs02_00305398 predicted 1394
9 SASI_Hs02_00305399 predicted 1301
10 SASI_Hs01_00027168 predicted 851
11 SASI_Hs01_00027169 predicted 1440
12 SASI_Hs01_00027171 predicted 575
13 SASI_Hs01_00027172 predicted 440
14 SASI_Hs01_00027173 predicted 409
15 SASI_Hs01_00027174 predicted 684
16 SASI_Hs01_00027175 predicted 431
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145055 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00230919 predicted 1574
2 SASI_Hs01_00230920 predicted 580
3 SASI_Hs01_00230923 predicted 513
4 SASI_Hs02_00364944 predicted 1573
5 SASI_Hs02_00364945 predicted 1572
6 SASI_Hs02_00364946 predicted 529
7 SASI_Hs02_00364947 predicted 866
8 SASI_Hs02_00364948 predicted 1580
9 SASI_Hs02_00364949 predicted 1477
10 SASI_Hs01_00230921 predicted 847
11 SASI_Hs01_00230922 predicted 1618
12 SASI_Hs01_00230924 predicted 575
13 SASI_Hs01_00230925 predicted 450
14 SASI_Hs01_00230926 predicted 409
15 SASI_Hs01_00230927 predicted 682
16 SASI_Hs01_00230928 predicted 432
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145055
VALIDATED
C18orf25 MISSION shRNA Bacterial Glycerol Stock
chromosome 18 open reading frame 25
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145055.1-1235s1c1
Sequence:CCGGGATGAGGATAGCAGGCGTAAACTCGAGTTTACGCCTGCTATCCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130621    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_145055.1-656s1c1
Sequence:CCGGCAGGACAGTAGTACCAGTGATCTCGAGATCACTGGTACTACTGTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128008    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145055.1-371s1c1
Sequence:CCGGGATACGTTGTCTTCCGCAGAACTCGAGTTCTGCGGAAGACAACGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145055.1-297s1c1
Sequence:CCGGGCCGAGTTTATGAGAGTGACTCTCGAGAGTCACTCTCATAAACTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127918    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145055.1-1142s1c1
Sequence:CCGGCAGTATGTTAGCACCAGGCAACTCGAGTTGCCTGGTGCTAACATACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130629    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_145055.1-358s1c1
Sequence:CCGGCCTGGCTGATTCAGATACGTTCTCGAGAACGTATCTGAATCAGCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145055.1-83s1c1
Sequence:CCGGGAAGAACTCATTGAGTCCGAACTCGAGTTCGGACTCAATGAGTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330520    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145055.3-685s21c1
Sequence:CCGGCCTGGCTGATTCAGATACGTTCTCGAGAACGTATCTGAATCAGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_145055.3-983s21c1
Sequence:CCGGCAGGACAGTAGTACCAGTGATCTCGAGATCACTGGTACTACTGTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330523    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145055.3-2039s21c1
Sequence:CCGGCATATCAGTCAGGTCCTTATTCTCGAGAATAAGGACCTGACTGATATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330522    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145055.3-1562s21c1
Sequence:CCGGGATGAGGATAGCAGGCGTAAACTCGAGTTTACGCCTGCTATCCTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145055
VALIDATED
C18orf25 MISSION shRNA shRNA Plasmid DNA
chromosome 18 open reading frame 25
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145055.1-1235s1c1
Sequence:CCGGGATGAGGATAGCAGGCGTAAACTCGAGTTTACGCCTGCTATCCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130621    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_145055.1-656s1c1
Sequence:CCGGCAGGACAGTAGTACCAGTGATCTCGAGATCACTGGTACTACTGTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128008    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145055.1-371s1c1
Sequence:CCGGGATACGTTGTCTTCCGCAGAACTCGAGTTCTGCGGAAGACAACGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145055.1-297s1c1
Sequence:CCGGGCCGAGTTTATGAGAGTGACTCTCGAGAGTCACTCTCATAAACTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127918    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145055.1-1142s1c1
Sequence:CCGGCAGTATGTTAGCACCAGGCAACTCGAGTTGCCTGGTGCTAACATACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130629    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_145055.1-358s1c1
Sequence:CCGGCCTGGCTGATTCAGATACGTTCTCGAGAACGTATCTGAATCAGCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145055.1-83s1c1
Sequence:CCGGGAAGAACTCATTGAGTCCGAACTCGAGTTCGGACTCAATGAGTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330520    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145055.3-685s21c1
Sequence:CCGGCCTGGCTGATTCAGATACGTTCTCGAGAACGTATCTGAATCAGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_145055.3-983s21c1
Sequence:CCGGCAGGACAGTAGTACCAGTGATCTCGAGATCACTGGTACTACTGTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330523    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145055.3-2039s21c1
Sequence:CCGGCATATCAGTCAGGTCCTTATTCTCGAGAATAAGGACCTGACTGATATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330522    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145055.3-1562s21c1
Sequence:CCGGGATGAGGATAGCAGGCGTAAACTCGAGTTTACGCCTGCTATCCTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145055
VALIDATED
C18orf25 MISSION shRNA Lentiviral Transduction Particles
chromosome 18 open reading frame 25
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145055.1-1235s1c1
Sequence:CCGGGATGAGGATAGCAGGCGTAAACTCGAGTTTACGCCTGCTATCCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130621    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_145055.1-656s1c1
Sequence:CCGGCAGGACAGTAGTACCAGTGATCTCGAGATCACTGGTACTACTGTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128008    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145055.1-371s1c1
Sequence:CCGGGATACGTTGTCTTCCGCAGAACTCGAGTTCTGCGGAAGACAACGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145055.1-297s1c1
Sequence:CCGGGCCGAGTTTATGAGAGTGACTCTCGAGAGTCACTCTCATAAACTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127918    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145055.1-1142s1c1
Sequence:CCGGCAGTATGTTAGCACCAGGCAACTCGAGTTGCCTGGTGCTAACATACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130629    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_145055.1-358s1c1
Sequence:CCGGCCTGGCTGATTCAGATACGTTCTCGAGAACGTATCTGAATCAGCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145055.1-83s1c1
Sequence:CCGGGAAGAACTCATTGAGTCCGAACTCGAGTTCGGACTCAATGAGTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330520    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145055.3-685s21c1
Sequence:CCGGCCTGGCTGATTCAGATACGTTCTCGAGAACGTATCTGAATCAGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_145055.3-983s21c1
Sequence:CCGGCAGGACAGTAGTACCAGTGATCTCGAGATCACTGGTACTACTGTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330523    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145055.3-2039s21c1
Sequence:CCGGCATATCAGTCAGGTCCTTATTCTCGAGAATAAGGACCTGACTGATATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330522    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145055.3-1562s21c1
Sequence:CCGGGATGAGGATAGCAGGCGTAAACTCGAGTTTACGCCTGCTATCCTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks