EMAIL THIS PAGE TO A FRIEND

C18orf32

chromosome 18 open reading frame 32

22 Gene Product Result for
UniProtKB ID: Q8TCD1
Gene ID:
chicken(426844) chromosome Z open reading frame, human C18orf32
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001035005 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001035005 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001035005 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU160121 MISSION® esiRNA esiRNA human C18orf32 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001035005 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001035005 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00218399 predicted 498
2 SASI_Hs01_00218400 predicted 627
3 SASI_Hs01_00218401 predicted 575
4 SASI_Hs02_00308166 predicted 544
5 SASI_Hs01_00218403 predicted 653
6 SASI_Hs01_00218404 predicted 237
7 SASI_Hs01_00218405 predicted 716
8 SASI_Hs01_00218406 predicted 534
9 SASI_Hs01_00218407 predicted 715
10 SASI_Hs02_00308167 predicted 657
11 SASI_Hs01_00218402 predicted 536
12 SASI_Hs01_00218408 predicted 531
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001035005
VALIDATED
C18orf32 MISSION shRNA Bacterial Glycerol Stock
chromosome 18 open reading frame 32
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000283970    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_001035005.2-242s21c1
Sequence:CCGGAGTTCTGCTCTGGATCTACAACTCGAGTTGTAGATCCAGAGCAGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281699    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_001035005.2-378s21c1
Sequence:CCGGGGTGCAGACATGAATGGATTACTCGAGTAATCCATTCATGTCTGCACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_001035005.2-310s21c1
Sequence:CCGGGTCGTATATGGCCTAAGAAAGCTCGAGCTTTCTTAGGCCATATACGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269195    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_001035005.2-356s21c1
Sequence:CCGGCAAAGGCAAAGTAAACTTTAACTCGAGTTAAAGTTTACTTTGCCTTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269251    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_001035005.2-544s21c1
Sequence:CCGGTCAGGATAGGAGTCTAGATATCTCGAGATATCTAGACTCCTATCCTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182986    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001035005.1-446s1c1
Sequence:CCGGCCTGATAATATGAAGCATCTTCTCGAGAAGATGCTTCATATTATCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179152    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001035005.1-206s1c1
Sequence:CCGGGTTCTGCTCTGGATCTACAAACTCGAGTTTGTAGATCCAGAGCAGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182953    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001035005.1-374s1c1
Sequence:CCGGCCAACAGAAATCTGTGATAAACTCGAGTTTATCACAGATTTCTGTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001035005
VALIDATED
C18orf32 MISSION shRNA shRNA Plasmid DNA
chromosome 18 open reading frame 32
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000283970    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_001035005.2-242s21c1
Sequence:CCGGAGTTCTGCTCTGGATCTACAACTCGAGTTGTAGATCCAGAGCAGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000281699    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_001035005.2-378s21c1
Sequence:CCGGGGTGCAGACATGAATGGATTACTCGAGTAATCCATTCATGTCTGCACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000269193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_001035005.2-310s21c1
Sequence:CCGGGTCGTATATGGCCTAAGAAAGCTCGAGCTTTCTTAGGCCATATACGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000269195    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_001035005.2-356s21c1
Sequence:CCGGCAAAGGCAAAGTAAACTTTAACTCGAGTTAAAGTTTACTTTGCCTTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000269251    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_001035005.2-544s21c1
Sequence:CCGGTCAGGATAGGAGTCTAGATATCTCGAGATATCTAGACTCCTATCCTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182986    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001035005.1-446s1c1
Sequence:CCGGCCTGATAATATGAAGCATCTTCTCGAGAAGATGCTTCATATTATCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179152    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001035005.1-206s1c1
Sequence:CCGGGTTCTGCTCTGGATCTACAAACTCGAGTTTGTAGATCCAGAGCAGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182953    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001035005.1-374s1c1
Sequence:CCGGCCAACAGAAATCTGTGATAAACTCGAGTTTATCACAGATTTCTGTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001035005
VALIDATED
C18orf32 MISSION shRNA Lentiviral Transduction Particles
chromosome 18 open reading frame 32
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000283970    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_001035005.2-242s21c1
Sequence:CCGGAGTTCTGCTCTGGATCTACAACTCGAGTTGTAGATCCAGAGCAGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281699    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_001035005.2-378s21c1
Sequence:CCGGGGTGCAGACATGAATGGATTACTCGAGTAATCCATTCATGTCTGCACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_001035005.2-310s21c1
Sequence:CCGGGTCGTATATGGCCTAAGAAAGCTCGAGCTTTCTTAGGCCATATACGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269195    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_001035005.2-356s21c1
Sequence:CCGGCAAAGGCAAAGTAAACTTTAACTCGAGTTAAAGTTTACTTTGCCTTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269251    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_001035005.2-544s21c1
Sequence:CCGGTCAGGATAGGAGTCTAGATATCTCGAGATATCTAGACTCCTATCCTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182986    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001035005.1-446s1c1
Sequence:CCGGCCTGATAATATGAAGCATCTTCTCGAGAAGATGCTTCATATTATCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179152    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001035005.1-206s1c1
Sequence:CCGGGTTCTGCTCTGGATCTACAAACTCGAGTTTGTAGATCCAGAGCAGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182953    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001035005.1-374s1c1
Sequence:CCGGCCAACAGAAATCTGTGATAAACTCGAGTTTATCACAGATTTCTGTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)