EMAIL THIS PAGE TO A FRIEND

C18orf42

chromosome 18 open reading frame 42

69 Gene Product Result for
Species: Human C18orf42(642597)
UniProtKB ID: P0CW23
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001145194 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001145194 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001145194 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001719925 Rosetta Predictions human pricing
XM_001719927 Rosetta Predictions human pricing
XM_931384 Rosetta Predictions human pricing
XM_931389 Rosetta Predictions human pricing
XM_945724 Rosetta Predictions human pricing
XM_945726 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001719925 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00433464 predicted 416
2 SASI_Hs02_00433465 predicted 316
3 SASI_Hs02_00433466 predicted 426
4 SASI_Hs02_00433467 predicted 405
5 SASI_Hs02_00433468 predicted 425
6 SASI_Hs02_00433469 predicted 449
7 SASI_Hs02_00433470 predicted 412
8 SASI_Hs02_00433471 predicted 450
9 SASI_Hs02_00433472 predicted 345
10 SASI_Hs02_00433473 predicted 423
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001719927 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00433484 predicted 257
2 SASI_Hs02_00433485 predicted 259
3 SASI_Hs02_00433486 predicted 244
4 SASI_Hs02_00433487 predicted 262
5 SASI_Hs02_00433488 predicted 277
6 SASI_Hs02_00433489 predicted 284
7 SASI_Hs02_00433490 predicted 251
8 SASI_Hs02_00433491 predicted 287
9 SASI_Hs02_00433492 predicted 298
10 SASI_Hs02_00433493 predicted 266
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_931384 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00267478 predicted 254
2 SASI_Hs01_00267479 predicted 258
3 SASI_Hs01_00267480 predicted 244
4 SASI_Hs01_00267481 predicted 257
5 SASI_Hs02_00481362 predicted 274
6 SASI_Hs01_00267483 predicted 284
7 SASI_Hs01_00267484 predicted 248
8 SASI_Hs01_00267485 predicted 291
9 SASI_Hs01_00267486 predicted 297
10 SASI_Hs01_00267487 predicted 268
11 SASI_Hs01_00267482 predicted 234
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_931389 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00268361 predicted 413
2 SASI_Hs01_00268363 predicted 312
3 SASI_Hs02_00481363 predicted 423
4 SASI_Hs01_00268364 predicted 407
5 SASI_Hs02_00481364 predicted 421
6 SASI_Hs02_00481365 predicted 441
7 SASI_Hs01_00268367 predicted 416
8 SASI_Hs02_00481366 predicted 451
9 SASI_Hs01_00268369 predicted 342
10 SASI_Hs02_00481367 predicted 429
11 SASI_Hs01_00268360 predicted 223
12 SASI_Hs01_00268362 predicted 200
13 SASI_Hs01_00268365 predicted 303
14 SASI_Hs01_00268366 predicted 199
15 SASI_Hs01_00268368 predicted 216
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_945724 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00486937 predicted 250
2 SASI_Hs02_00486938 predicted 265
3 SASI_Hs02_00486939 predicted 250
4 SASI_Hs02_00486940 predicted 261
5 SASI_Hs02_00486941 predicted 279
6 SASI_Hs02_00486942 predicted 280
7 SASI_Hs02_00486943 predicted 247
8 SASI_Hs02_00486944 predicted 290
9 SASI_Hs02_00486945 predicted 300
10 SASI_Hs02_00486946 predicted 263
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_945726 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00486947 predicted 416
2 SASI_Hs02_00486948 predicted 311
3 SASI_Hs02_00486949 predicted 429
4 SASI_Hs02_00486950 predicted 409
5 SASI_Hs02_00486951 predicted 427
6 SASI_Hs02_00486952 predicted 443
7 SASI_Hs02_00486953 predicted 409
8 SASI_Hs02_00486954 predicted 457
9 SASI_Hs02_00486955 predicted 340
10 SASI_Hs02_00486956 predicted 430
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001145194
C18orf42 MISSION shRNA Bacterial Glycerol Stock
chromosome 18 open reading frame 42
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000377650    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145194.1-385s21c1
Sequence:CCGGAGTTAACCAAGAAGCACGAAACTCGAGTTTCGTGCTTCTTGGTTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337281    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145194.1-253s21c1
Sequence:CCGGAGCTGCAGAATGCCAGCAAACCTCGAGGTTTGCTGGCATTCTGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337282    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001145194.1-893s21c1
Sequence:CCGGGGTTCAGGTCTAAGATCAAATCTCGAGATTTGATCTTAGACCTGAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337280    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145194.1-276s21c1
Sequence:CCGGATTGTGCAGAATGCAATCCTGCTCGAGCAGGATTGCATTCTGCACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000377625    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145194.1-235s21c1
Sequence:CCGGATGAGCCTGAAGAGGTGAAGCCTCGAGGCTTCACCTCTTCAGGCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145194.1-287s21c1
Sequence:CCGGTGCAATCCTGCAAGCTGTGCACTCGAGTGCACAGCTTGCAGGATTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371118    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001145194.1-449s21c1
Sequence:CCGGCTAGCCTTCCTCTTAGTATAGCTCGAGCTATACTAAGAGGAAGGCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145194.1-406s21c1
Sequence:CCGGAGAAGTAACATGGTGGATTTGCTCGAGCAAATCCACCATGTTACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001145194
C18orf42 MISSION shRNA shRNA Plasmid DNA
chromosome 18 open reading frame 42
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000377650    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145194.1-385s21c1
Sequence:CCGGAGTTAACCAAGAAGCACGAAACTCGAGTTTCGTGCTTCTTGGTTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337281    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145194.1-253s21c1
Sequence:CCGGAGCTGCAGAATGCCAGCAAACCTCGAGGTTTGCTGGCATTCTGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337282    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001145194.1-893s21c1
Sequence:CCGGGGTTCAGGTCTAAGATCAAATCTCGAGATTTGATCTTAGACCTGAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337280    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145194.1-276s21c1
Sequence:CCGGATTGTGCAGAATGCAATCCTGCTCGAGCAGGATTGCATTCTGCACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000377625    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145194.1-235s21c1
Sequence:CCGGATGAGCCTGAAGAGGTGAAGCCTCGAGGCTTCACCTCTTCAGGCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145194.1-287s21c1
Sequence:CCGGTGCAATCCTGCAAGCTGTGCACTCGAGTGCACAGCTTGCAGGATTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371118    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001145194.1-449s21c1
Sequence:CCGGCTAGCCTTCCTCTTAGTATAGCTCGAGCTATACTAAGAGGAAGGCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145194.1-406s21c1
Sequence:CCGGAGAAGTAACATGGTGGATTTGCTCGAGCAAATCCACCATGTTACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001145194
C18orf42 MISSION shRNA Lentiviral Transduction Particles
chromosome 18 open reading frame 42
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000377650    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145194.1-385s21c1
Sequence:CCGGAGTTAACCAAGAAGCACGAAACTCGAGTTTCGTGCTTCTTGGTTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337281    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145194.1-253s21c1
Sequence:CCGGAGCTGCAGAATGCCAGCAAACCTCGAGGTTTGCTGGCATTCTGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337282    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001145194.1-893s21c1
Sequence:CCGGGGTTCAGGTCTAAGATCAAATCTCGAGATTTGATCTTAGACCTGAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337280    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145194.1-276s21c1
Sequence:CCGGATTGTGCAGAATGCAATCCTGCTCGAGCAGGATTGCATTCTGCACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000377625    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145194.1-235s21c1
Sequence:CCGGATGAGCCTGAAGAGGTGAAGCCTCGAGGCTTCACCTCTTCAGGCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145194.1-287s21c1
Sequence:CCGGTGCAATCCTGCAAGCTGTGCACTCGAGTGCACAGCTTGCAGGATTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371118    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001145194.1-449s21c1
Sequence:CCGGCTAGCCTTCCTCTTAGTATAGCTCGAGCTATACTAAGAGGAAGGCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145194.1-406s21c1
Sequence:CCGGAGAAGTAACATGGTGGATTTGCTCGAGCAAATCCACCATGTTACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks