EMAIL THIS PAGE TO A FRIEND

C18orf54

chromosome 18 open reading frame 54

101 Gene Product Result for
Synonyms: LAS2
Species: Human C18orf54(162681)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173529 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173529 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173529 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU030921 MISSION® esiRNA esiRNA human C18orf54 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173529 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173529 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00085413 predicted 1166
2 SASI_Hs01_00085414 predicted 1095
3 SASI_Hs01_00085415 predicted 215
4 SASI_Hs01_00085416 predicted 476
5 SASI_Hs02_00368320 predicted 440
6 SASI_Hs01_00085417 predicted 238
7 SASI_Hs01_00085418 predicted 1297
8 SASI_Hs01_00085420 predicted 1016
9 SASI_Hs01_00085421 predicted 1270
10 SASI_Hs01_00085422 predicted 1130
11 SASI_Hs01_00085419 predicted 871
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173529
VALIDATED
C18orf54 MISSION shRNA Bacterial Glycerol Stock
chromosome 18 open reading frame 54
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000371512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_173529.4-264s21c1
Sequence:CCGGCAAGCTCTACAGGCTTATATTCTCGAGAATATAAGCCTGTAGAGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371513    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173529.4-1342s21c1
Sequence:CCGGTGGTTGGTTCAAGGATTATATCTCGAGATATAATCCTTGAACCAACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_173529.4-444s21c1
Sequence:CCGGTGTAGAAGACACACCGTTAATCTCGAGATTAACGGTGTGTCTTCTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168723    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173529.3-301s1c1
Sequence:CCGGGCCAAATATATCCTGGTGCAACTCGAGTTGCACCAGGATATATTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167833    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173529.3-1124s1c1
Sequence:CCGGGAAGGAAAGTATGATTCCTATCTCGAGATAGGAATCATACTTTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167168    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_173529.3-1272s1c1
Sequence:CCGGCCACAGAACAAATAGGCATTTCTCGAGAAATGCCTATTTGTTCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167617    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173529.3-223s1c1
Sequence:CCGGGCTCGTTTCACTATAAAGATACTCGAGTATCTTTATAGTGAAACGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167834    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_173529.3-481s1c1
Sequence:CCGGGCCTAACAACTGATGATCTATCTCGAGATAGATCATCAGTTGTTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173529
VALIDATED
C18orf54 MISSION shRNA shRNA Plasmid DNA
chromosome 18 open reading frame 54
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000371512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_173529.4-264s21c1
Sequence:CCGGCAAGCTCTACAGGCTTATATTCTCGAGAATATAAGCCTGTAGAGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371513    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173529.4-1342s21c1
Sequence:CCGGTGGTTGGTTCAAGGATTATATCTCGAGATATAATCCTTGAACCAACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_173529.4-444s21c1
Sequence:CCGGTGTAGAAGACACACCGTTAATCTCGAGATTAACGGTGTGTCTTCTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168723    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173529.3-301s1c1
Sequence:CCGGGCCAAATATATCCTGGTGCAACTCGAGTTGCACCAGGATATATTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167833    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173529.3-1124s1c1
Sequence:CCGGGAAGGAAAGTATGATTCCTATCTCGAGATAGGAATCATACTTTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167168    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_173529.3-1272s1c1
Sequence:CCGGCCACAGAACAAATAGGCATTTCTCGAGAAATGCCTATTTGTTCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167617    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173529.3-223s1c1
Sequence:CCGGGCTCGTTTCACTATAAAGATACTCGAGTATCTTTATAGTGAAACGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167834    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_173529.3-481s1c1
Sequence:CCGGGCCTAACAACTGATGATCTATCTCGAGATAGATCATCAGTTGTTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173529
VALIDATED
C18orf54 MISSION shRNA Lentiviral Transduction Particles
chromosome 18 open reading frame 54
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000371512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_173529.4-264s21c1
Sequence:CCGGCAAGCTCTACAGGCTTATATTCTCGAGAATATAAGCCTGTAGAGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371513    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173529.4-1342s21c1
Sequence:CCGGTGGTTGGTTCAAGGATTATATCTCGAGATATAATCCTTGAACCAACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_173529.4-444s21c1
Sequence:CCGGTGTAGAAGACACACCGTTAATCTCGAGATTAACGGTGTGTCTTCTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168723    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173529.3-301s1c1
Sequence:CCGGGCCAAATATATCCTGGTGCAACTCGAGTTGCACCAGGATATATTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167833    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173529.3-1124s1c1
Sequence:CCGGGAAGGAAAGTATGATTCCTATCTCGAGATAGGAATCATACTTTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167168    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_173529.3-1272s1c1
Sequence:CCGGCCACAGAACAAATAGGCATTTCTCGAGAAATGCCTATTTGTTCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167617    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173529.3-223s1c1
Sequence:CCGGGCTCGTTTCACTATAAAGATACTCGAGTATCTTTATAGTGAAACGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167834    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_173529.3-481s1c1
Sequence:CCGGGCCTAACAACTGATGATCTATCTCGAGATAGATCATCAGTTGTTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks