EMAIL THIS PAGE TO A FRIEND

C18orf8

chromosome 18 open reading frame 8

41 Gene Product Result for
Synonyms: HsT2591 MIC1 Mic-1
UniProtKB ID: Q96DM3, Q9BU17, Q9Y5M0
Gene ID:
Human(29919) Summary: This gene encodes a colon cancer associated protein. [provided by RefSeq, Jan 2013]
chicken(421075) chromosome 2 open reading frame, human C18orf8
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013326 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_013326 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_013326 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU042251 MISSION® esiRNA esiRNA human C18orf8 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_013326 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013326 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00209636 predicted 686
2 SASI_Hs01_00209637 predicted 1883
3 SASI_Hs01_00209638 predicted 839
4 SASI_Hs01_00209640 predicted 1119
5 SASI_Hs01_00209641 predicted 1620
6 SASI_Hs02_00344630 predicted 1718
7 SASI_Hs01_00209642 predicted 496
8 SASI_Hs01_00209644 predicted 1833
9 SASI_Hs01_00209645 predicted 784
10 SASI_Hs02_00344631 predicted 1592
11 SASI_Hs01_00209639 predicted 1114
12 SASI_Hs01_00209643 predicted 1181
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013326
VALIDATED
C18orf8 MISSION shRNA Bacterial Glycerol Stock
chromosome 18 open reading frame 8
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000273556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_013326.3-716s21c1
Sequence:CCGGGCTGCGCCTAAGTCAACTAAACTCGAGTTTAGTTGACTTAGGCGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273502    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013326.3-963s21c1
Sequence:CCGGATACAGAGACATCGGTAATATCTCGAGATATTACCGATGTCTCTGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_013326.3-567s21c1
Sequence:CCGGGCCACAATCTCAATGTGAATTCTCGAGAATTCACATTGAGATTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273501    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013326.3-271s21c1
Sequence:CCGGCCCAGATGATAGGAATCCCATCTCGAGATGGGATTCCTATCATCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273503    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_013326.3-757s21c1
Sequence:CCGGCATCGCAATGGCTACCATATACTCGAGTATATGGTAGCCATTGCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013326.2-681s1c1
Sequence:CCGGCCCAAGTTTGAGATTGAATTACTCGAGTAATTCAATCTCAAACTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005424    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_013326.2-1250s1c1
Sequence:CCGGCCTCCAGAGAAAGGAATGCAACTCGAGTTGCATTCCTTTCTCTGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013326.2-556s1c1
Sequence:CCGGGCCACAATCTCAATGTGAATTCTCGAGAATTCACATTGAGATTGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_013326.2-1817s1c1
Sequence:CCGGCCTTTCCAAACACCAAGTGTTCTCGAGAACACTTGGTGTTTGGAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005427    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_013326.2-260s1c1
Sequence:CCGGCCCAGATGATAGGAATCCCATCTCGAGATGGGATTCCTATCATCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013326
VALIDATED
C18orf8 MISSION shRNA shRNA Plasmid DNA
chromosome 18 open reading frame 8
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000273556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_013326.3-716s21c1
Sequence:CCGGGCTGCGCCTAAGTCAACTAAACTCGAGTTTAGTTGACTTAGGCGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273502    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013326.3-963s21c1
Sequence:CCGGATACAGAGACATCGGTAATATCTCGAGATATTACCGATGTCTCTGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_013326.3-567s21c1
Sequence:CCGGGCCACAATCTCAATGTGAATTCTCGAGAATTCACATTGAGATTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273501    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013326.3-271s21c1
Sequence:CCGGCCCAGATGATAGGAATCCCATCTCGAGATGGGATTCCTATCATCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273503    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_013326.3-757s21c1
Sequence:CCGGCATCGCAATGGCTACCATATACTCGAGTATATGGTAGCCATTGCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013326.2-681s1c1
Sequence:CCGGCCCAAGTTTGAGATTGAATTACTCGAGTAATTCAATCTCAAACTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005424    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_013326.2-1250s1c1
Sequence:CCGGCCTCCAGAGAAAGGAATGCAACTCGAGTTGCATTCCTTTCTCTGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013326.2-556s1c1
Sequence:CCGGGCCACAATCTCAATGTGAATTCTCGAGAATTCACATTGAGATTGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_013326.2-1817s1c1
Sequence:CCGGCCTTTCCAAACACCAAGTGTTCTCGAGAACACTTGGTGTTTGGAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005427    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_013326.2-260s1c1
Sequence:CCGGCCCAGATGATAGGAATCCCATCTCGAGATGGGATTCCTATCATCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013326
VALIDATED
C18orf8 MISSION shRNA Lentiviral Transduction Particles
chromosome 18 open reading frame 8
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000273556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_013326.3-716s21c1
Sequence:CCGGGCTGCGCCTAAGTCAACTAAACTCGAGTTTAGTTGACTTAGGCGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273502    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013326.3-963s21c1
Sequence:CCGGATACAGAGACATCGGTAATATCTCGAGATATTACCGATGTCTCTGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_013326.3-567s21c1
Sequence:CCGGGCCACAATCTCAATGTGAATTCTCGAGAATTCACATTGAGATTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273501    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013326.3-271s21c1
Sequence:CCGGCCCAGATGATAGGAATCCCATCTCGAGATGGGATTCCTATCATCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273503    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_013326.3-757s21c1
Sequence:CCGGCATCGCAATGGCTACCATATACTCGAGTATATGGTAGCCATTGCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013326.2-681s1c1
Sequence:CCGGCCCAAGTTTGAGATTGAATTACTCGAGTAATTCAATCTCAAACTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005424    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_013326.2-1250s1c1
Sequence:CCGGCCTCCAGAGAAAGGAATGCAACTCGAGTTGCATTCCTTTCTCTGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013326.2-556s1c1
Sequence:CCGGGCCACAATCTCAATGTGAATTCTCGAGAATTCACATTGAGATTGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_013326.2-1817s1c1
Sequence:CCGGCCTTTCCAAACACCAAGTGTTCTCGAGAACACTTGGTGTTTGGAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005427    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_013326.2-260s1c1
Sequence:CCGGCCCAGATGATAGGAATCCCATCTCGAGATGGGATTCCTATCATCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks