EMAIL THIS PAGE TO A FRIEND

C19orf10

chromosome 19 open reading frame 10

23 Gene Product Result for
Synonyms: EUROIMAGE1875335 IL25 IL27 IL27w R33729_1 SF20
Species: Human C19orf10(56005)
UniProtKB ID: Q969H8, D6W628, O75256, O75272, Q9BTK7, Q9NP69
Gene ID:
Human(56005) Summary: The protein encoded by this gene was previously thought to support proliferation of lymphoid cells and was considered an interleukin. However, this activity has not been reproducible and the function of this protein is currently unknown. [provided by RefSeq, Jul 2008]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019107 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_019107 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_019107 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU045981 MISSION® esiRNA esiRNA human C19orf10 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_019107 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019107 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00157911 predicted 266
2 SASI_Hs02_00352734 predicted 434
3 SASI_Hs01_00157912 predicted 205
4 SASI_Hs01_00157913 predicted 360
5 SASI_Hs01_00157914 predicted 279
6 SASI_Hs01_00157915 predicted 449
7 SASI_Hs01_00157916 predicted 206
8 SASI_Hs01_00157917 predicted 263
9 SASI_Hs01_00157919 predicted 409
10 SASI_Hs01_00157920 predicted 282
11 SASI_Hs01_00157918 predicted 318
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019107
VALIDATED
C19orf10 MISSION shRNA Bacterial Glycerol Stock
chromosome 19 open reading frame 10
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000115907    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_019107.3-799s1c1
Sequence:CCGGACAGCTTCTCAGTTCCCACTTCTCGAGAAGTGGGAACTGAGAAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115911    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_019107.3-213s1c1
Sequence:CCGGGCATTCCTTCTCCCATAACGTCTCGAGACGTTATGGGAGAAGGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115910    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_019107.3-541s1c1
Sequence:CCGGGAGCTGTCCAAGCTGGTGATTCTCGAGAATCACCAGCTTGGACAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115908    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_019107.3-433s1c1
Sequence:CCGGGCCTACTCTAAAGCCGCATTTCTCGAGAAATGCGGCTTTAGAGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019107.3-372s1c1
Sequence:CCGGCTATCTGTACTTCACACAGTTCTCGAGAACTGTGTGAAGTACAGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292132    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019107.3-433s21c1
Sequence:CCGGGCCTACTCTAAAGCCGCATTTCTCGAGAAATGCGGCTTTAGAGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292133    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019107.3-541s21c1
Sequence:CCGGGAGCTGTCCAAGCTGGTGATTCTCGAGAATCACCAGCTTGGACAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292134    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019107.3-213s21c1
Sequence:CCGGGCATTCCTTCTCCCATAACGTCTCGAGACGTTATGGGAGAAGGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292078    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019107.3-372s21c1
Sequence:CCGGCTATCTGTACTTCACACAGTTCTCGAGAACTGTGTGAAGTACAGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292135    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019107.3-799s21c1
Sequence:CCGGACAGCTTCTCAGTTCCCACTTCTCGAGAAGTGGGAACTGAGAAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019107
VALIDATED
C19orf10 MISSION shRNA shRNA Plasmid DNA
chromosome 19 open reading frame 10
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000115907    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_019107.3-799s1c1
Sequence:CCGGACAGCTTCTCAGTTCCCACTTCTCGAGAAGTGGGAACTGAGAAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115911    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_019107.3-213s1c1
Sequence:CCGGGCATTCCTTCTCCCATAACGTCTCGAGACGTTATGGGAGAAGGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115910    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_019107.3-541s1c1
Sequence:CCGGGAGCTGTCCAAGCTGGTGATTCTCGAGAATCACCAGCTTGGACAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115908    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_019107.3-433s1c1
Sequence:CCGGGCCTACTCTAAAGCCGCATTTCTCGAGAAATGCGGCTTTAGAGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019107.3-372s1c1
Sequence:CCGGCTATCTGTACTTCACACAGTTCTCGAGAACTGTGTGAAGTACAGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292132    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019107.3-433s21c1
Sequence:CCGGGCCTACTCTAAAGCCGCATTTCTCGAGAAATGCGGCTTTAGAGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292133    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019107.3-541s21c1
Sequence:CCGGGAGCTGTCCAAGCTGGTGATTCTCGAGAATCACCAGCTTGGACAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292134    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019107.3-213s21c1
Sequence:CCGGGCATTCCTTCTCCCATAACGTCTCGAGACGTTATGGGAGAAGGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292078    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019107.3-372s21c1
Sequence:CCGGCTATCTGTACTTCACACAGTTCTCGAGAACTGTGTGAAGTACAGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292135    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019107.3-799s21c1
Sequence:CCGGACAGCTTCTCAGTTCCCACTTCTCGAGAAGTGGGAACTGAGAAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019107
VALIDATED
C19orf10 MISSION shRNA Lentiviral Transduction Particles
chromosome 19 open reading frame 10
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000115907    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_019107.3-799s1c1
Sequence:CCGGACAGCTTCTCAGTTCCCACTTCTCGAGAAGTGGGAACTGAGAAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115911    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_019107.3-213s1c1
Sequence:CCGGGCATTCCTTCTCCCATAACGTCTCGAGACGTTATGGGAGAAGGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115910    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_019107.3-541s1c1
Sequence:CCGGGAGCTGTCCAAGCTGGTGATTCTCGAGAATCACCAGCTTGGACAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115908    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_019107.3-433s1c1
Sequence:CCGGGCCTACTCTAAAGCCGCATTTCTCGAGAAATGCGGCTTTAGAGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019107.3-372s1c1
Sequence:CCGGCTATCTGTACTTCACACAGTTCTCGAGAACTGTGTGAAGTACAGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292132    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019107.3-433s21c1
Sequence:CCGGGCCTACTCTAAAGCCGCATTTCTCGAGAAATGCGGCTTTAGAGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292133    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019107.3-541s21c1
Sequence:CCGGGAGCTGTCCAAGCTGGTGATTCTCGAGAATCACCAGCTTGGACAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292134    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019107.3-213s21c1
Sequence:CCGGGCATTCCTTCTCCCATAACGTCTCGAGACGTTATGGGAGAAGGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292078    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019107.3-372s21c1
Sequence:CCGGCTATCTGTACTTCACACAGTTCTCGAGAACTGTGTGAAGTACAGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292135    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019107.3-799s21c1
Sequence:CCGGACAGCTTCTCAGTTCCCACTTCTCGAGAAGTGGGAACTGAGAAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks