EMAIL THIS PAGE TO A FRIEND

C19orf12

chromosome 19 open reading frame 12

Synonyms: NBIA3 NBIA4 SPG43
Species: Human C19orf12(83636)
UniProtKB ID: Q9NSK7, B3KQ16, Q0D2Q0, Q6P4C5, Q9BSL7
Gene ID:
Human(83636) Summary: This gene encodes a small transmembrane protein. Mutations in this gene are a cause of neurodegeneration with brain iron accumulation-4 (NBIA4), but the specific function of the encoded protein is unknown. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
48 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_031448 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_031448 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_031448 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU090501 MISSION® esiRNA esiRNA human C19orf12 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001031726 Rosetta Predictions human pricing
NM_031448 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001031726 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00124815 predicted 685
2 SASI_Hs01_00124811 predicted 709
3 SASI_Hs02_00307775 predicted 1064
4 SASI_Hs02_00307776 predicted 150
5 SASI_Hs01_00124813 predicted 563
6 SASI_Hs01_00124814 predicted 349
7 SASI_Hs01_00124809 predicted 766
8 SASI_Hs02_00307777 predicted 406
9 SASI_Hs01_00124810 predicted 770
10 SASI_Hs02_00307778 predicted 405
11 SASI_Hs01_00124806 predicted 637
12 SASI_Hs01_00124807 predicted 643
13 SASI_Hs01_00124808 predicted 635
14 SASI_Hs01_00124812 predicted 826
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031448 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00358857 predicted 957
2 SASI_Hs01_00038146 predicted 974
3 SASI_Hs01_00038140 predicted 1336
4 SASI_Hs02_00358858 predicted 832
5 SASI_Hs02_00358859 predicted 618
6 SASI_Hs01_00038142 predicted 1006
7 SASI_Hs01_00038144 predicted 1039
8 SASI_Hs02_00358860 predicted 680
9 SASI_Hs01_00038145 predicted 1040
10 SASI_Hs02_00358861 predicted 671
11 SASI_Hs01_00038139 predicted 509
12 SASI_Hs01_00038141 predicted 504
13 SASI_Hs01_00038143 predicted 827
14 SASI_Hs01_00038147 predicted 686
15 SASI_Hs01_00038148 predicted 815
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031448
VALIDATED
C19orf12 MISSION shRNA Bacterial Glycerol Stock
chromosome 19 open reading frame 12
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166577    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_031448.2-170s1c1
Sequence:CCGGCGAGCAACAGAGGCTCTTTAACTCGAGTTAAAGAGCCTCTGTTGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164358    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_031448.2-1156s1c1
Sequence:CCGGCCAGTGCATCTAAGTCATGTTCTCGAGAACATGACTTAGATGCACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165325    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_031448.2-171s1c1
Sequence:CCGGGAGCAACAGAGGCTCTTTAACCTCGAGGTTAAAGAGCCTCTGTTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166351    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_031448.2-325s1c1
Sequence:CCGGCCGAGATCCAGTATGATGACTCTCGAGAGTCATCATACTGGATCTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_031448.2-173s1c1
Sequence:CCGGGCAACAGAGGCTCTTTAACGACTCGAGTCGTTAAAGAGCCTCTGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_031448.2-326s1c1
Sequence:CCGGCGAGATCCAGTATGATGACTACTCGAGTAGTCATCATACTGGATCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160025    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_031448.2-375s1c1
Sequence:CCGGCCTTTAAATGACTCTGTGATTCTCGAGAATCACAGAGTCATTTAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162023    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_031448.2-1336s1c1
Sequence:CCGGGCTGCTACAAACCTTCAATTTCTCGAGAAATTGAAGGTTTGTAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162497    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_031448.2-1193s1c1
Sequence:CCGGCCACTAAATGTGCAATAGCATCTCGAGATGCTATTGCACATTTAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163370    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_031448.2-1188s1c1
Sequence:CCGGGCAGTCCACTAAATGTGCAATCTCGAGATTGCACATTTAGTGGACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031448
VALIDATED
C19orf12 MISSION shRNA shRNA Plasmid DNA
chromosome 19 open reading frame 12
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166577    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_031448.2-170s1c1
Sequence:CCGGCGAGCAACAGAGGCTCTTTAACTCGAGTTAAAGAGCCTCTGTTGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164358    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_031448.2-1156s1c1
Sequence:CCGGCCAGTGCATCTAAGTCATGTTCTCGAGAACATGACTTAGATGCACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165325    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_031448.2-171s1c1
Sequence:CCGGGAGCAACAGAGGCTCTTTAACCTCGAGGTTAAAGAGCCTCTGTTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166351    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_031448.2-325s1c1
Sequence:CCGGCCGAGATCCAGTATGATGACTCTCGAGAGTCATCATACTGGATCTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_031448.2-173s1c1
Sequence:CCGGGCAACAGAGGCTCTTTAACGACTCGAGTCGTTAAAGAGCCTCTGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_031448.2-326s1c1
Sequence:CCGGCGAGATCCAGTATGATGACTACTCGAGTAGTCATCATACTGGATCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160025    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_031448.2-375s1c1
Sequence:CCGGCCTTTAAATGACTCTGTGATTCTCGAGAATCACAGAGTCATTTAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162023    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_031448.2-1336s1c1
Sequence:CCGGGCTGCTACAAACCTTCAATTTCTCGAGAAATTGAAGGTTTGTAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162497    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_031448.2-1193s1c1
Sequence:CCGGCCACTAAATGTGCAATAGCATCTCGAGATGCTATTGCACATTTAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163370    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_031448.2-1188s1c1
Sequence:CCGGGCAGTCCACTAAATGTGCAATCTCGAGATTGCACATTTAGTGGACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031448
VALIDATED
C19orf12 MISSION shRNA Lentiviral Transduction Particles
chromosome 19 open reading frame 12
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166577    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_031448.2-170s1c1
Sequence:CCGGCGAGCAACAGAGGCTCTTTAACTCGAGTTAAAGAGCCTCTGTTGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164358    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_031448.2-1156s1c1
Sequence:CCGGCCAGTGCATCTAAGTCATGTTCTCGAGAACATGACTTAGATGCACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165325    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_031448.2-171s1c1
Sequence:CCGGGAGCAACAGAGGCTCTTTAACCTCGAGGTTAAAGAGCCTCTGTTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166351    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_031448.2-325s1c1
Sequence:CCGGCCGAGATCCAGTATGATGACTCTCGAGAGTCATCATACTGGATCTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_031448.2-173s1c1
Sequence:CCGGGCAACAGAGGCTCTTTAACGACTCGAGTCGTTAAAGAGCCTCTGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_031448.2-326s1c1
Sequence:CCGGCGAGATCCAGTATGATGACTACTCGAGTAGTCATCATACTGGATCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160025    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_031448.2-375s1c1
Sequence:CCGGCCTTTAAATGACTCTGTGATTCTCGAGAATCACAGAGTCATTTAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162023    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_031448.2-1336s1c1
Sequence:CCGGGCTGCTACAAACCTTCAATTTCTCGAGAAATTGAAGGTTTGTAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162497    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_031448.2-1193s1c1
Sequence:CCGGCCACTAAATGTGCAATAGCATCTCGAGATGCTATTGCACATTTAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163370    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_031448.2-1188s1c1
Sequence:CCGGGCAGTCCACTAAATGTGCAATCTCGAGATTGCACATTTAGTGGACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks