EMAIL THIS PAGE TO A FRIEND

C19orf18

chromosome 19 open reading frame 18

28 Gene Product Result for
Species: Human C19orf18(147685)
UniProtKB ID: Q8NEA5
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152474 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152474 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152474 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152474 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152474 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00219402 predicted 626
2 SASI_Hs01_00219403 predicted 588
3 SASI_Hs01_00219404 predicted 380
4 SASI_Hs01_00219405 predicted 345
5 SASI_Hs01_00219406 predicted 433
6 SASI_Hs01_00219407 predicted 447
7 SASI_Hs02_00366247 predicted 390
8 SASI_Hs01_00219408 predicted 497
9 SASI_Hs01_00219409 predicted 251
10 SASI_Hs01_00219410 predicted 583
11 SASI_Hs01_00219411 predicted 629
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152474
C19orf18 MISSION shRNA Bacterial Glycerol Stock
chromosome 19 open reading frame 18
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000149894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152474.2-525s1c1
Sequence:CCGGGAACCTCAGGATACCGTTATTCTCGAGAATAACGGTATCCTGAGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152474.2-384s1c1
Sequence:CCGGGCATAGACCTGCTCTTGTTAACTCGAGTTAACAAGAGCAGGTCTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147768    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152474.2-453s1c1
Sequence:CCGGGATGGCAATCTCCTATATGATCTCGAGATCATATAGGAGATTGCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152474.2-717s1c1
Sequence:CCGGGAATGCGTCACATAATGGAAACTCGAGTTTCCATTATGTGACGCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152474.2-265s1c1
Sequence:CCGGGAGCCCAAAGTGTTCTTTCATCTCGAGATGAAAGAACACTTTGGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152474.4-148s21c1
Sequence:CCGGATGGAATGCCAACTTCATTTACTCGAGTAAATGAAGTTGGCATTCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430079    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152474.4-350s21c1
Sequence:CCGGTGAAATTCCTGAGGAATAAAGCTCGAGCTTTATTCCTCAGGAATTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152474
C19orf18 MISSION shRNA shRNA Plasmid DNA
chromosome 19 open reading frame 18
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000149894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152474.2-525s1c1
Sequence:CCGGGAACCTCAGGATACCGTTATTCTCGAGAATAACGGTATCCTGAGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152474.2-384s1c1
Sequence:CCGGGCATAGACCTGCTCTTGTTAACTCGAGTTAACAAGAGCAGGTCTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147768    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152474.2-453s1c1
Sequence:CCGGGATGGCAATCTCCTATATGATCTCGAGATCATATAGGAGATTGCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152474.2-717s1c1
Sequence:CCGGGAATGCGTCACATAATGGAAACTCGAGTTTCCATTATGTGACGCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152474.2-265s1c1
Sequence:CCGGGAGCCCAAAGTGTTCTTTCATCTCGAGATGAAAGAACACTTTGGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152474.4-148s21c1
Sequence:CCGGATGGAATGCCAACTTCATTTACTCGAGTAAATGAAGTTGGCATTCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430079    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152474.4-350s21c1
Sequence:CCGGTGAAATTCCTGAGGAATAAAGCTCGAGCTTTATTCCTCAGGAATTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152474
C19orf18 MISSION shRNA Lentiviral Transduction Particles
chromosome 19 open reading frame 18
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000149894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152474.2-525s1c1
Sequence:CCGGGAACCTCAGGATACCGTTATTCTCGAGAATAACGGTATCCTGAGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152474.2-384s1c1
Sequence:CCGGGCATAGACCTGCTCTTGTTAACTCGAGTTAACAAGAGCAGGTCTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147768    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152474.2-453s1c1
Sequence:CCGGGATGGCAATCTCCTATATGATCTCGAGATCATATAGGAGATTGCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152474.2-717s1c1
Sequence:CCGGGAATGCGTCACATAATGGAAACTCGAGTTTCCATTATGTGACGCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152474.2-265s1c1
Sequence:CCGGGAGCCCAAAGTGTTCTTTCATCTCGAGATGAAAGAACACTTTGGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152474.4-148s21c1
Sequence:CCGGATGGAATGCCAACTTCATTTACTCGAGTAAATGAAGTTGGCATTCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430079    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152474.4-350s21c1
Sequence:CCGGTGAAATTCCTGAGGAATAAAGCTCGAGCTTTATTCCTCAGGAATTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks