EMAIL THIS PAGE TO A FRIEND

C19orf24

chromosome 19 open reading frame 24

23 Gene Product Result for
Species: Human C19orf24(55009)
UniProtKB ID: Q9BVV8, Q9NWS2
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017914 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017914 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017914 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU029971 MISSION® esiRNA esiRNA human C19orf24 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017914 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017914 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00143614 predicted 512
2 SASI_Hs02_00350895 predicted 400
3 SASI_Hs01_00143616 predicted 807
4 SASI_Hs02_00350896 predicted 359
5 SASI_Hs02_00350897 predicted 326
6 SASI_Hs01_00143622 predicted 736
7 SASI_Hs02_00350898 predicted 731
8 SASI_Hs02_00350899 predicted 396
9 SASI_Hs02_00350900 predicted 720
10 SASI_Hs02_00350901 predicted 399
11 SASI_Hs01_00143615 predicted 815
12 SASI_Hs01_00143617 predicted 636
13 SASI_Hs01_00143618 predicted 691
14 SASI_Hs01_00143619 predicted 691
15 SASI_Hs01_00143620 predicted 690
16 SASI_Hs01_00143621 predicted 691
17 SASI_Hs01_00143623 predicted 809
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017914
VALIDATED
C19orf24 MISSION shRNA Bacterial Glycerol Stock
chromosome 19 open reading frame 24
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000281664    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_017914.3-736s21c1
Sequence:CCGGCTGACTGTGACTTGTGCCTCTCTCGAGAGAGGCACAAGTCACAGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281666    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_017914.3-300s21c1
Sequence:CCGGCGGGCGTTTAGGTTGAAGAAGCTCGAGCTTCTTCAACCTAAACGCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_017914.3-250s21c1
Sequence:CCGGTCTACGTGATCCTGGGCTTCTCTCGAGAGAAGCCCAGGATCACGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_017914.3-399s21c1
Sequence:CCGGACGGTGTTTGAGTCCCGGAATCTCGAGATTCCGGGACTCAAACACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017914
VALIDATED
C19orf24 MISSION shRNA shRNA Plasmid DNA
chromosome 19 open reading frame 24
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000281664    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_017914.3-736s21c1
Sequence:CCGGCTGACTGTGACTTGTGCCTCTCTCGAGAGAGGCACAAGTCACAGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281666    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_017914.3-300s21c1
Sequence:CCGGCGGGCGTTTAGGTTGAAGAAGCTCGAGCTTCTTCAACCTAAACGCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_017914.3-250s21c1
Sequence:CCGGTCTACGTGATCCTGGGCTTCTCTCGAGAGAAGCCCAGGATCACGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_017914.3-399s21c1
Sequence:CCGGACGGTGTTTGAGTCCCGGAATCTCGAGATTCCGGGACTCAAACACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017914
VALIDATED
C19orf24 MISSION shRNA Lentiviral Transduction Particles
chromosome 19 open reading frame 24
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000281664    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_017914.3-736s21c1
Sequence:CCGGCTGACTGTGACTTGTGCCTCTCTCGAGAGAGGCACAAGTCACAGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281666    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_017914.3-300s21c1
Sequence:CCGGCGGGCGTTTAGGTTGAAGAAGCTCGAGCTTCTTCAACCTAAACGCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_017914.3-250s21c1
Sequence:CCGGTCTACGTGATCCTGGGCTTCTCTCGAGAGAAGCCCAGGATCACGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_017914.3-399s21c1
Sequence:CCGGACGGTGTTTGAGTCCCGGAATCTCGAGATTCCGGGACTCAAACACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks