EMAIL THIS PAGE TO A FRIEND

C19orf25

chromosome 19 open reading frame 25

21 Gene Product Result for
Species: Human C19orf25(148223)
UniProtKB ID: Q9UFG5, B3KQN6, Q8N9R7, Q8WV94
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152482 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152482 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152482 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU122381 MISSION® esiRNA esiRNA human C19orf25 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152482 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152482 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00183714 predicted 197
2 SASI_Hs01_00183705 predicted 817
3 SASI_Hs01_00183706 predicted 920
4 SASI_Hs01_00183707 predicted 572
5 SASI_Hs01_00183708 predicted 806
6 SASI_Hs01_00183709 predicted 676
7 SASI_Hs02_00366258 predicted 784
8 SASI_Hs01_00183712 predicted 670
9 SASI_Hs01_00183710 predicted 703
10 SASI_Hs02_00366259 predicted 566
11 SASI_Hs01_00183711 predicted 539
12 SASI_Hs01_00183713 predicted 704
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152482
C19orf25 MISSION shRNA Bacterial Glycerol Stock
chromosome 19 open reading frame 25
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000172592    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152482.1-1464s1c1
Sequence:CCGGGACTTCTCACTGGTCATGCTTCTCGAGAAGCATGACCAGTGAGAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167426    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152482.1-546s1c1
Sequence:CCGGGATAGGGACATTATTGCTGTACTCGAGTACAGCAATAATGTCCCTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167062    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152482.1-1339s1c1
Sequence:CCGGCCAGCTTTGTTTCTTGAATGTCTCGAGACATTCAAGAAACAAAGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166987    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152482.1-1343s1c1
Sequence:CCGGCTTTGTTTCTTGAATGTGGAACTCGAGTTCCACATTCAAGAAACAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152482
C19orf25 MISSION shRNA shRNA Plasmid DNA
chromosome 19 open reading frame 25
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000172592    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152482.1-1464s1c1
Sequence:CCGGGACTTCTCACTGGTCATGCTTCTCGAGAAGCATGACCAGTGAGAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167426    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152482.1-546s1c1
Sequence:CCGGGATAGGGACATTATTGCTGTACTCGAGTACAGCAATAATGTCCCTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167062    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152482.1-1339s1c1
Sequence:CCGGCCAGCTTTGTTTCTTGAATGTCTCGAGACATTCAAGAAACAAAGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166987    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152482.1-1343s1c1
Sequence:CCGGCTTTGTTTCTTGAATGTGGAACTCGAGTTCCACATTCAAGAAACAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152482
C19orf25 MISSION shRNA Lentiviral Transduction Particles
chromosome 19 open reading frame 25
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000172592    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152482.1-1464s1c1
Sequence:CCGGGACTTCTCACTGGTCATGCTTCTCGAGAAGCATGACCAGTGAGAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167426    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152482.1-546s1c1
Sequence:CCGGGATAGGGACATTATTGCTGTACTCGAGTACAGCAATAATGTCCCTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167062    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152482.1-1339s1c1
Sequence:CCGGCCAGCTTTGTTTCTTGAATGTCTCGAGACATTCAAGAAACAAAGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166987    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152482.1-1343s1c1
Sequence:CCGGCTTTGTTTCTTGAATGTGGAACTCGAGTTCCACATTCAAGAAACAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks