EMAIL THIS PAGE TO A FRIEND

C19orf26

chromosome 19 open reading frame 26

23 Gene Product Result for
Synonyms: DOS
Species: Human C19orf26(255057)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152769 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152769 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152769 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU120601 MISSION® esiRNA esiRNA human C19orf26 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152769 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152769 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00218119 predicted 1943
2 SASI_Hs01_00218120 predicted 1100
3 SASI_Hs01_00218123 predicted 1938
4 SASI_Hs01_00218124 predicted 1690
5 SASI_Hs02_00366707 predicted 730
6 SASI_Hs01_00218125 predicted 957
7 SASI_Hs01_00218126 predicted 663
8 SASI_Hs01_00218127 predicted 1936
9 SASI_Hs02_00366708 predicted 697
10 SASI_Hs02_00366709 predicted 1927
11 SASI_Hs01_00218121 predicted 1936
12 SASI_Hs01_00218122 predicted 1673
13 SASI_Hs01_00218128 predicted 868
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152769
C19orf26 MISSION shRNA Bacterial Glycerol Stock
chromosome 19 open reading frame 26
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000180713    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152769.1-583s1c1
Sequence:CCGGGACTTCCACCACCTGAAGAATCTCGAGATTCTTCAGGTGGTGGAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179507    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152769.1-1168s1c1
Sequence:CCGGGAGGACTTCATCCAGTACATTCTCGAGAATGTACTGGATGAAGTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180281    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152769.1-1931s1c1
Sequence:CCGGCGGAGAGAAGCATGTTGACTTCTCGAGAAGTCAACATGCTTCTCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000282791    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152769.2-325s21c1
Sequence:CCGGTGACGACGTCGTGGGACAATGCTCGAGCATTGTCCCACGACGTCGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000282792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152769.2-1318s21c1
Sequence:CCGGAGGACTTCATCCAGTACATTGCTCGAGCAATGTACTGGATGAAGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263746    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152769.2-731s21c1
Sequence:CCGGGGACTTCCACCACCTGAAGAACTCGAGTTCTTCAGGTGGTGGAAGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263748    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152769.2-2148s21c1
Sequence:CCGGATGGAGGCACCCTGCTTAATACTCGAGTATTAAGCAGGGTGCCTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152769.2-790s21c1
Sequence:CCGGTTGTCACCATCCACGAGTGTGCTCGAGCACACTCGTGGATGGTGACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152769
C19orf26 MISSION shRNA shRNA Plasmid DNA
chromosome 19 open reading frame 26
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000180713    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152769.1-583s1c1
Sequence:CCGGGACTTCCACCACCTGAAGAATCTCGAGATTCTTCAGGTGGTGGAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179507    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152769.1-1168s1c1
Sequence:CCGGGAGGACTTCATCCAGTACATTCTCGAGAATGTACTGGATGAAGTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180281    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152769.1-1931s1c1
Sequence:CCGGCGGAGAGAAGCATGTTGACTTCTCGAGAAGTCAACATGCTTCTCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000282791    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152769.2-325s21c1
Sequence:CCGGTGACGACGTCGTGGGACAATGCTCGAGCATTGTCCCACGACGTCGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000282792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152769.2-1318s21c1
Sequence:CCGGAGGACTTCATCCAGTACATTGCTCGAGCAATGTACTGGATGAAGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263746    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152769.2-731s21c1
Sequence:CCGGGGACTTCCACCACCTGAAGAACTCGAGTTCTTCAGGTGGTGGAAGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263748    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152769.2-2148s21c1
Sequence:CCGGATGGAGGCACCCTGCTTAATACTCGAGTATTAAGCAGGGTGCCTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152769.2-790s21c1
Sequence:CCGGTTGTCACCATCCACGAGTGTGCTCGAGCACACTCGTGGATGGTGACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152769
C19orf26 MISSION shRNA Lentiviral Transduction Particles
chromosome 19 open reading frame 26
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000180713    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152769.1-583s1c1
Sequence:CCGGGACTTCCACCACCTGAAGAATCTCGAGATTCTTCAGGTGGTGGAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179507    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152769.1-1168s1c1
Sequence:CCGGGAGGACTTCATCCAGTACATTCTCGAGAATGTACTGGATGAAGTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180281    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152769.1-1931s1c1
Sequence:CCGGCGGAGAGAAGCATGTTGACTTCTCGAGAAGTCAACATGCTTCTCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000282791    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152769.2-325s21c1
Sequence:CCGGTGACGACGTCGTGGGACAATGCTCGAGCATTGTCCCACGACGTCGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000282792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152769.2-1318s21c1
Sequence:CCGGAGGACTTCATCCAGTACATTGCTCGAGCAATGTACTGGATGAAGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263746    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152769.2-731s21c1
Sequence:CCGGGGACTTCCACCACCTGAAGAACTCGAGTTCTTCAGGTGGTGGAAGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263748    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152769.2-2148s21c1
Sequence:CCGGATGGAGGCACCCTGCTTAATACTCGAGTATTAAGCAGGGTGCCTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152769.2-790s21c1
Sequence:CCGGTTGTCACCATCCACGAGTGTGCTCGAGCACACTCGTGGATGGTGACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks