EMAIL THIS PAGE TO A FRIEND

C19orf33

chromosome 19 open reading frame 33

21 Gene Product Result for
Synonyms: H2RSP IMUP IMUP-1 IMUP-2
Species: Human C19orf33(64073)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_033520 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033520 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033520 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU123921 MISSION® esiRNA esiRNA human C19orf33 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_033520 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033520 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00032979 predicted 265
2 SASI_Hs01_00032981 predicted 236
3 SASI_Hs01_00032982 predicted 424
4 SASI_Hs01_00032983 predicted 429
5 SASI_Hs01_00032984 predicted 274
6 SASI_Hs01_00032985 predicted 420
7 SASI_Hs01_00032986 predicted 237
8 SASI_Hs01_00032988 predicted 225
9 SASI_Hs02_00361406 predicted 220
10 SASI_Hs02_00361407 predicted 281
11 SASI_Hs01_00032980 predicted 421
12 SASI_Hs01_00032987 predicted 277
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033520
C19orf33 MISSION shRNA Bacterial Glycerol Stock
chromosome 19 open reading frame 33
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000282789    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033520.1-291s21c1
Sequence:CCGGGATGTGAAGTCCCACGCTGCTCTCGAGAGCAGCGTGGGACTTCACATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033520.1-278s21c1
Sequence:CCGGCGATTCGGACACGGATGTGAACTCGAGTTCACATCCGTGTCCGAATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263744    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033520.1-235s21c1
Sequence:CCGGAGCAAGGACACCACAGCTCTTCTCGAGAAGAGCTGTGGTGTCCTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263745    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033520.1-247s21c1
Sequence:CCGGACAGCTCTTCCGACTCCAGCACTCGAGTGCTGGAGTCGGAAGAGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263743    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033520.1-224s21c1
Sequence:CCGGTCCGGGTCCAAAGCAAGGACACTCGAGTGTCCTTGCTTTGGACCCGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033520
C19orf33 MISSION shRNA shRNA Plasmid DNA
chromosome 19 open reading frame 33
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000282789    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033520.1-291s21c1
Sequence:CCGGGATGTGAAGTCCCACGCTGCTCTCGAGAGCAGCGTGGGACTTCACATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033520.1-278s21c1
Sequence:CCGGCGATTCGGACACGGATGTGAACTCGAGTTCACATCCGTGTCCGAATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263744    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033520.1-235s21c1
Sequence:CCGGAGCAAGGACACCACAGCTCTTCTCGAGAAGAGCTGTGGTGTCCTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263745    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033520.1-247s21c1
Sequence:CCGGACAGCTCTTCCGACTCCAGCACTCGAGTGCTGGAGTCGGAAGAGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263743    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033520.1-224s21c1
Sequence:CCGGTCCGGGTCCAAAGCAAGGACACTCGAGTGTCCTTGCTTTGGACCCGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033520
C19orf33 MISSION shRNA Lentiviral Transduction Particles
chromosome 19 open reading frame 33
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000282789    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033520.1-291s21c1
Sequence:CCGGGATGTGAAGTCCCACGCTGCTCTCGAGAGCAGCGTGGGACTTCACATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033520.1-278s21c1
Sequence:CCGGCGATTCGGACACGGATGTGAACTCGAGTTCACATCCGTGTCCGAATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263744    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033520.1-235s21c1
Sequence:CCGGAGCAAGGACACCACAGCTCTTCTCGAGAAGAGCTGTGGTGTCCTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263745    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033520.1-247s21c1
Sequence:CCGGACAGCTCTTCCGACTCCAGCACTCGAGTGCTGGAGTCGGAAGAGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263743    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033520.1-224s21c1
Sequence:CCGGTCCGGGTCCAAAGCAAGGACACTCGAGTGTCCTTGCTTTGGACCCGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)