EMAIL THIS PAGE TO A FRIEND

C19orf35

chromosome 19 open reading frame 35

15 Gene Product Result for
Species: Human C19orf35(374872)
UniProtKB ID: Q6ZS72
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198532 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198532 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198532 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_198532 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198532 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00032859 predicted 680
2 SASI_Hs01_00032860 predicted 1803
3 SASI_Hs01_00032861 predicted 1575
4 SASI_Hs01_00032862 predicted 1572
5 SASI_Hs01_00032863 predicted 1802
6 SASI_Hs01_00032864 predicted 1854
7 SASI_Hs01_00032865 predicted 1007
8 SASI_Hs01_00032867 predicted 1786
9 SASI_Hs01_00032868 predicted 761
10 SASI_Hs02_00372120 predicted 1685
11 SASI_Hs01_00032866 predicted 1574
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198532
C19orf35 MISSION shRNA Bacterial Glycerol Stock
chromosome 19 open reading frame 35
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000378383    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198532.2-274s21c1
Sequence:CCGGCCTGCCCAAGAAGATCCTAACCTCGAGGTTAGGATCTTCTTGGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359545    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198532.2-768s21c1
Sequence:CCGGCCCTGTCTCCACACTTCAATCCTCGAGGATTGAAGTGTGGAGACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359546    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198532.2-1582s21c1
Sequence:CCGGAGGTCAGCGTCTCCATGATAGCTCGAGCTATCATGGAGACGCTGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359614    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198532.2-1444s21c1
Sequence:CCGGGGACTGGCTGTGTTGCGAATACTCGAGTATTCGCAACACAGCCAGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194298    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198532.1-163s1c2
Sequence:CCGGGTATAGCAACCTTGGTCAGATCTCGAGATCTGACCAAGGTTGCTATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166757    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198532.1-2156s1c1
Sequence:CCGGCCGTGACACACCAACTTCTTTCTCGAGAAAGAAGTTGGTGTGTCACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164697    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198532.1-162s1c1
Sequence:CCGGCGTATAGCAACCTTGGTCAGACTCGAGTCTGACCAAGGTTGCTATACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166113    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198532.1-1942s1c1
Sequence:CCGGGCTGAAGATGGCCAGTGATTTCTCGAGAAATCACTGGCCATCTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166237    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198532.1-1809s1c1
Sequence:CCGGCGCTGATCAATGTCTCTCTGTCTCGAGACAGAGAGACATTGATCAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198532
C19orf35 MISSION shRNA shRNA Plasmid DNA
chromosome 19 open reading frame 35
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000378383    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198532.2-274s21c1
Sequence:CCGGCCTGCCCAAGAAGATCCTAACCTCGAGGTTAGGATCTTCTTGGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359545    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198532.2-768s21c1
Sequence:CCGGCCCTGTCTCCACACTTCAATCCTCGAGGATTGAAGTGTGGAGACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359546    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198532.2-1582s21c1
Sequence:CCGGAGGTCAGCGTCTCCATGATAGCTCGAGCTATCATGGAGACGCTGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359614    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198532.2-1444s21c1
Sequence:CCGGGGACTGGCTGTGTTGCGAATACTCGAGTATTCGCAACACAGCCAGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194298    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198532.1-163s1c2
Sequence:CCGGGTATAGCAACCTTGGTCAGATCTCGAGATCTGACCAAGGTTGCTATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166757    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198532.1-2156s1c1
Sequence:CCGGCCGTGACACACCAACTTCTTTCTCGAGAAAGAAGTTGGTGTGTCACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164697    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198532.1-162s1c1
Sequence:CCGGCGTATAGCAACCTTGGTCAGACTCGAGTCTGACCAAGGTTGCTATACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166113    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198532.1-1942s1c1
Sequence:CCGGGCTGAAGATGGCCAGTGATTTCTCGAGAAATCACTGGCCATCTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166237    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198532.1-1809s1c1
Sequence:CCGGCGCTGATCAATGTCTCTCTGTCTCGAGACAGAGAGACATTGATCAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198532
C19orf35 MISSION shRNA Lentiviral Transduction Particles
chromosome 19 open reading frame 35
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000378383    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198532.2-274s21c1
Sequence:CCGGCCTGCCCAAGAAGATCCTAACCTCGAGGTTAGGATCTTCTTGGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359545    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198532.2-768s21c1
Sequence:CCGGCCCTGTCTCCACACTTCAATCCTCGAGGATTGAAGTGTGGAGACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359546    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198532.2-1582s21c1
Sequence:CCGGAGGTCAGCGTCTCCATGATAGCTCGAGCTATCATGGAGACGCTGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359614    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198532.2-1444s21c1
Sequence:CCGGGGACTGGCTGTGTTGCGAATACTCGAGTATTCGCAACACAGCCAGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194298    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198532.1-163s1c2
Sequence:CCGGGTATAGCAACCTTGGTCAGATCTCGAGATCTGACCAAGGTTGCTATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166757    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198532.1-2156s1c1
Sequence:CCGGCCGTGACACACCAACTTCTTTCTCGAGAAAGAAGTTGGTGTGTCACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164697    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198532.1-162s1c1
Sequence:CCGGCGTATAGCAACCTTGGTCAGACTCGAGTCTGACCAAGGTTGCTATACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166113    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198532.1-1942s1c1
Sequence:CCGGGCTGAAGATGGCCAGTGATTTCTCGAGAAATCACTGGCCATCTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166237    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198532.1-1809s1c1
Sequence:CCGGCGCTGATCAATGTCTCTCTGTCTCGAGACAGAGAGACATTGATCAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks