EMAIL THIS PAGE TO A FRIEND

C19orf38

chromosome 19 open reading frame 38

78 Gene Product Result for
Synonyms: HIDE1
Species: Human C19orf38(255809)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001136482 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001136482 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001136482 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU141871 MISSION® esiRNA esiRNA human C19orf38 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001726718 Rosetta Predictions human pricing
XM_001726719 Rosetta Predictions human pricing
XM_172995 Rosetta Predictions human pricing
XM_930239 Rosetta Predictions human pricing
XM_938361 Rosetta Predictions human pricing
XM_943649 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001726718 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00476057 predicted 955
2 SASI_Hs02_00476058 predicted 593
3 SASI_Hs02_00476059 predicted 436
4 SASI_Hs02_00476060 predicted 560
5 SASI_Hs02_00476061 predicted 663
6 SASI_Hs02_00476062 predicted 881
7 SASI_Hs02_00476063 predicted 579
8 SASI_Hs02_00476064 predicted 993
9 SASI_Hs02_00476065 predicted 580
10 SASI_Hs02_00476066 predicted 620
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001726719 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00476067 predicted 402
2 SASI_Hs02_00476068 predicted 433
3 SASI_Hs02_00476069 predicted 356
4 SASI_Hs02_00476070 predicted 502
5 SASI_Hs02_00476071 predicted 416
6 SASI_Hs02_00476072 predicted 504
7 SASI_Hs02_00476073 predicted 464
8 SASI_Hs02_00476074 predicted 360
9 SASI_Hs02_00476075 predicted 441
10 SASI_Hs02_00476076 predicted 347
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_172995 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00478907 predicted 405
2 SASI_Hs01_00262836 predicted 434
3 SASI_Hs02_00478908 predicted 355
4 SASI_Hs02_00478909 predicted 502
5 SASI_Hs01_00262841 predicted 420
6 SASI_Hs02_00478910 predicted 496
7 SASI_Hs02_00478911 predicted 460
8 SASI_Hs02_00478912 predicted 362
9 SASI_Hs02_00478913 predicted 437
10 SASI_Hs02_00478914 predicted 350
11 SASI_Hs01_00262834 predicted 945
12 SASI_Hs01_00262835 predicted 583
13 SASI_Hs01_00262837 predicted 556
14 SASI_Hs01_00262838 predicted 653
15 SASI_Hs01_00262839 predicted 875
16 SASI_Hs01_00262840 predicted 564
17 SASI_Hs01_00262842 predicted 565
18 SASI_Hs01_00262843 predicted 608
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_930239 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00291460 predicted 400
2 SASI_Hs01_00291461 predicted 439
3 SASI_Hs01_00291462 predicted 353
4 SASI_Hs01_00291464 predicted 421
5 SASI_Hs01_00291466 predicted 465
6 SASI_Hs01_00291467 predicted 367
7 SASI_Hs02_00481283 predicted 443
8 SASI_Hs01_00291468 predicted 352
9 SASI_Hs02_00481284 predicted 466
10 SASI_Hs02_00481285 predicted 579
11 SASI_Hs01_00291463 predicted 492
12 SASI_Hs01_00291465 predicted 495
13 SASI_Hs01_00291469 predicted 217
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_938361 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00483074 predicted 403
2 SASI_Hs02_00483075 predicted 431
3 SASI_Hs02_00483076 predicted 353
4 SASI_Hs02_00483077 predicted 499
5 SASI_Hs02_00483078 predicted 420
6 SASI_Hs02_00483079 predicted 503
7 SASI_Hs02_00483080 predicted 463
8 SASI_Hs02_00483081 predicted 367
9 SASI_Hs02_00483082 predicted 442
10 SASI_Hs02_00483083 predicted 347
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_943649 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00486115 predicted 955
2 SASI_Hs02_00486116 predicted 595
3 SASI_Hs02_00486117 predicted 439
4 SASI_Hs02_00486118 predicted 564
5 SASI_Hs02_00486119 predicted 666
6 SASI_Hs02_00486120 predicted 875
7 SASI_Hs02_00486121 predicted 580
8 SASI_Hs02_00486122 predicted 998
9 SASI_Hs02_00486123 predicted 578
10 SASI_Hs02_00486124 predicted 619
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001136482
C19orf38 MISSION shRNA Bacterial Glycerol Stock
chromosome 19 open reading frame 38
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000282921    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136482.1-339s21c1
Sequence:CCGGACTGCCAGTATGGAGTGTTAGCTCGAGCTAACACTCCATACTGGCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136482.1-580s21c1
Sequence:CCGGCACAGACATGTCCTTCGATAACTCGAGTTATCGAAGGACATGTCTGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000282924    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001136482.1-855s21c1
Sequence:CCGGGCCACTTTCTCAGGGAATTGGCTCGAGCCAATTCCCTGAGAAAGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264129    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136482.1-550s21c1
Sequence:CCGGATCCTGCTGGGCCCAGATTAACTCGAGTTAATCTGGGCCCAGCAGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264131    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136482.1-216s21c1
Sequence:CCGGGGGCGAATTTCACACTGTATCCTCGAGGATACAGTGTGAAATTCGCCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001136482
C19orf38 MISSION shRNA shRNA Plasmid DNA
chromosome 19 open reading frame 38
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000282921    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136482.1-339s21c1
Sequence:CCGGACTGCCAGTATGGAGTGTTAGCTCGAGCTAACACTCCATACTGGCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136482.1-580s21c1
Sequence:CCGGCACAGACATGTCCTTCGATAACTCGAGTTATCGAAGGACATGTCTGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000282924    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001136482.1-855s21c1
Sequence:CCGGGCCACTTTCTCAGGGAATTGGCTCGAGCCAATTCCCTGAGAAAGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264129    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136482.1-550s21c1
Sequence:CCGGATCCTGCTGGGCCCAGATTAACTCGAGTTAATCTGGGCCCAGCAGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264131    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136482.1-216s21c1
Sequence:CCGGGGGCGAATTTCACACTGTATCCTCGAGGATACAGTGTGAAATTCGCCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001136482
C19orf38 MISSION shRNA Lentiviral Transduction Particles
chromosome 19 open reading frame 38
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000282921    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136482.1-339s21c1
Sequence:CCGGACTGCCAGTATGGAGTGTTAGCTCGAGCTAACACTCCATACTGGCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136482.1-580s21c1
Sequence:CCGGCACAGACATGTCCTTCGATAACTCGAGTTATCGAAGGACATGTCTGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000282924    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001136482.1-855s21c1
Sequence:CCGGGCCACTTTCTCAGGGAATTGGCTCGAGCCAATTCCCTGAGAAAGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264129    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136482.1-550s21c1
Sequence:CCGGATCCTGCTGGGCCCAGATTAACTCGAGTTAATCTGGGCCCAGCAGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264131    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136482.1-216s21c1
Sequence:CCGGGGGCGAATTTCACACTGTATCCTCGAGGATACAGTGTGAAATTCGCCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)