EMAIL THIS PAGE TO A FRIEND

C19orf40

chromosome 19 open reading frame 40

29 Gene Product Result for
Synonyms: FAAP24
Species: Human C19orf40(91442)
Gene ID:
Human(91442) Summary: FAAP24 is a component of the Fanconi anemia (FA) core complex (see MIM 227650), which plays a crucial role in DNA damage response (Ciccia et al., 2007 [PubMed 17289582]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152266 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152266 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152266 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU002241 MISSION® esiRNA esiRNA targeting human C19orf40 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152266 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152266 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00142392 predicted 501
2 SASI_Hs02_00365776 predicted 334
3 SASI_Hs01_00142393 predicted 400
4 SASI_Hs01_00142394 predicted 300
5 SASI_Hs01_00142395 predicted 340
6 SASI_Hs01_00142396 predicted 491
7 SASI_Hs01_00142397 predicted 275
8 SASI_Hs01_00142398 predicted 302
9 SASI_Hs02_00365777 predicted 501
10 SASI_Hs01_00142400 predicted 326
11 SASI_Hs01_00142391 predicted 250
12 SASI_Hs01_00142399 predicted 498
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152266
VALIDATED
C19orf40 MISSION shRNA Bacterial Glycerol Stock
chromosome 19 open reading frame 40
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000285281    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_152266.3-398s21c1
Sequence:CCGGACCCGGATGAGTGAACAATACCTCGAGGTATTGTTCACTCATCCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274971    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_152266.3-277s21c1
Sequence:CCGGGAACAGATGCTGCATTCTTTACTCGAGTAAAGAATGCAGCATCTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275042    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_152266.3-869s21c1
Sequence:CCGGCGCCTCTAATCTCAGCACTTTCTCGAGAAAGTGCTGAGATTAGAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275043    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_152266.3-336s21c1
Sequence:CCGGGAAAGAGGCTTGTTCGGGTTACTCGAGTAACCCGAACAAGCCTCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152266.1-406s1c1
Sequence:CCGGGAAGTTTACTGTGCTGGACCTCTCGAGAGGTCCAGCACAGTAAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138659    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152266.1-625s1c1
Sequence:CCGGCCAGAAGTTTCCAAGCATCCACTCGAGTGGATGCTTGGAAACTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152266.1-221s1c1
Sequence:CCGGGATGGCTTGACACCAGACTTTCTCGAGAAAGTCTGGTGTCAAGCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137740    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_152266.1-309s1c1
Sequence:CCGGGAAAGAGGCTTGTTCGGGTTACTCGAGTAACCCGAACAAGCCTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137633    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152266.1-774s1c1
Sequence:CCGGGACCACAAACACCAGGATCTTCTCGAGAAGATCCTGGTGTTTGTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152266.1-647s1c1
Sequence:CCGGCAACTGAGTAATGCTTCCATTCTCGAGAATGGAAGCATTACTCAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136865    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152266.1-777s1c1
Sequence:CCGGCACAAACACCAGGATCTTGTTCTCGAGAACAAGATCCTGGTGTTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138644    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_152266.1-842s1c1
Sequence:CCGGCGCCTCTAATCTCAGCACTTTCTCGAGAAAGTGCTGAGATTAGAGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152266
VALIDATED
C19orf40 MISSION shRNA shRNA Plasmid DNA
chromosome 19 open reading frame 40
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000285281    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_152266.3-398s21c1
Sequence:CCGGACCCGGATGAGTGAACAATACCTCGAGGTATTGTTCACTCATCCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274971    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_152266.3-277s21c1
Sequence:CCGGGAACAGATGCTGCATTCTTTACTCGAGTAAAGAATGCAGCATCTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275042    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_152266.3-869s21c1
Sequence:CCGGCGCCTCTAATCTCAGCACTTTCTCGAGAAAGTGCTGAGATTAGAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275043    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_152266.3-336s21c1
Sequence:CCGGGAAAGAGGCTTGTTCGGGTTACTCGAGTAACCCGAACAAGCCTCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152266.1-406s1c1
Sequence:CCGGGAAGTTTACTGTGCTGGACCTCTCGAGAGGTCCAGCACAGTAAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138659    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152266.1-625s1c1
Sequence:CCGGCCAGAAGTTTCCAAGCATCCACTCGAGTGGATGCTTGGAAACTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152266.1-221s1c1
Sequence:CCGGGATGGCTTGACACCAGACTTTCTCGAGAAAGTCTGGTGTCAAGCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137740    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_152266.1-309s1c1
Sequence:CCGGGAAAGAGGCTTGTTCGGGTTACTCGAGTAACCCGAACAAGCCTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137633    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152266.1-774s1c1
Sequence:CCGGGACCACAAACACCAGGATCTTCTCGAGAAGATCCTGGTGTTTGTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152266.1-647s1c1
Sequence:CCGGCAACTGAGTAATGCTTCCATTCTCGAGAATGGAAGCATTACTCAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136865    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152266.1-777s1c1
Sequence:CCGGCACAAACACCAGGATCTTGTTCTCGAGAACAAGATCCTGGTGTTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138644    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_152266.1-842s1c1
Sequence:CCGGCGCCTCTAATCTCAGCACTTTCTCGAGAAAGTGCTGAGATTAGAGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152266
VALIDATED
C19orf40 MISSION shRNA Lentiviral Transduction Particles
chromosome 19 open reading frame 40
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000285281    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_152266.3-398s21c1
Sequence:CCGGACCCGGATGAGTGAACAATACCTCGAGGTATTGTTCACTCATCCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274971    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_152266.3-277s21c1
Sequence:CCGGGAACAGATGCTGCATTCTTTACTCGAGTAAAGAATGCAGCATCTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275042    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_152266.3-869s21c1
Sequence:CCGGCGCCTCTAATCTCAGCACTTTCTCGAGAAAGTGCTGAGATTAGAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275043    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_152266.3-336s21c1
Sequence:CCGGGAAAGAGGCTTGTTCGGGTTACTCGAGTAACCCGAACAAGCCTCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152266.1-406s1c1
Sequence:CCGGGAAGTTTACTGTGCTGGACCTCTCGAGAGGTCCAGCACAGTAAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138659    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152266.1-625s1c1
Sequence:CCGGCCAGAAGTTTCCAAGCATCCACTCGAGTGGATGCTTGGAAACTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152266.1-221s1c1
Sequence:CCGGGATGGCTTGACACCAGACTTTCTCGAGAAAGTCTGGTGTCAAGCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137740    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_152266.1-309s1c1
Sequence:CCGGGAAAGAGGCTTGTTCGGGTTACTCGAGTAACCCGAACAAGCCTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137633    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152266.1-774s1c1
Sequence:CCGGGACCACAAACACCAGGATCTTCTCGAGAAGATCCTGGTGTTTGTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152266.1-647s1c1
Sequence:CCGGCAACTGAGTAATGCTTCCATTCTCGAGAATGGAAGCATTACTCAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136865    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152266.1-777s1c1
Sequence:CCGGCACAAACACCAGGATCTTGTTCTCGAGAACAAGATCCTGGTGTTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138644    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_152266.1-842s1c1
Sequence:CCGGCGCCTCTAATCTCAGCACTTTCTCGAGAAAGTGCTGAGATTAGAGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks