EMAIL THIS PAGE TO A FRIEND

C19orf43

chromosome 19 open reading frame 43

48 Gene Product Result for
Synonyms: fSAP18
Species: Human C19orf43(79002)
UniProtKB ID: Q9BQ61
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024038 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024038 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024038 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU140261 MISSION® esiRNA esiRNA human C19orf43 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024038 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024038 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00148415 predicted 428
2 SASI_Hs01_00148417 predicted 430
3 SASI_Hs01_00148418 predicted 478
4 SASI_Hs01_00148419 predicted 215
5 SASI_Hs01_00148421 predicted 385
6 SASI_Hs01_00148422 predicted 471
7 SASI_Hs02_00356462 predicted 414
8 SASI_Hs01_00148423 predicted 539
9 SASI_Hs01_00148424 predicted 469
10 SASI_Hs02_00356463 predicted 536
11 SASI_Hs01_00148416 predicted 476
12 SASI_Hs01_00148420 predicted 513
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024038
VALIDATED
C19orf43 MISSION shRNA Bacterial Glycerol Stock
chromosome 19 open reading frame 43
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000455027    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024038.2-393s21c1
Sequence:CCGGCACTTAGCTTCGTGGGCAAACCTCGAGGTTTGCCCACGAAGCTAAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074483    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024038.2-762s1c1
Sequence:CCGGGCCTCGTGAGACTTCATAGAACTCGAGTTCTATGAAGTCTCACGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024038.2-471s1c1
Sequence:CCGGCGGAGGATGAGGTATTAACAACTCGAGTTGTTAATACCTCATCCTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074487    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024038.2-442s1c1
Sequence:CCGGGACGGGAATAGTAGCCAAGAACTCGAGTTCTTGGCTACTATTCCCGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024038.2-468s1c1
Sequence:CCGGAGACGGAGGATGAGGTATTAACTCGAGTTAATACCTCATCCTCCGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437696    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024038.2-259s21c1
Sequence:CCGGGCTGTTCAAGCGGAAGATGGACTCGAGTCCATCTTCCGCTTGAACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428321    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024038.2-482s21c1
Sequence:CCGGGTATTAACAAGTAAAGGTGACCTCGAGGTCACCTTTACTTGTTAATACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000222577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024038.2-220s1c2
Sequence:CCGGCGGCGTGAACTTGTTCGCCAACTCGAGTTGGCGAACAAGTTCACGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024038
VALIDATED
C19orf43 MISSION shRNA shRNA Plasmid DNA
chromosome 19 open reading frame 43
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000455027    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024038.2-393s21c1
Sequence:CCGGCACTTAGCTTCGTGGGCAAACCTCGAGGTTTGCCCACGAAGCTAAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074483    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024038.2-762s1c1
Sequence:CCGGGCCTCGTGAGACTTCATAGAACTCGAGTTCTATGAAGTCTCACGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024038.2-471s1c1
Sequence:CCGGCGGAGGATGAGGTATTAACAACTCGAGTTGTTAATACCTCATCCTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074487    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024038.2-442s1c1
Sequence:CCGGGACGGGAATAGTAGCCAAGAACTCGAGTTCTTGGCTACTATTCCCGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024038.2-468s1c1
Sequence:CCGGAGACGGAGGATGAGGTATTAACTCGAGTTAATACCTCATCCTCCGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437696    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024038.2-259s21c1
Sequence:CCGGGCTGTTCAAGCGGAAGATGGACTCGAGTCCATCTTCCGCTTGAACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428321    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024038.2-482s21c1
Sequence:CCGGGTATTAACAAGTAAAGGTGACCTCGAGGTCACCTTTACTTGTTAATACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000222577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024038.2-220s1c2
Sequence:CCGGCGGCGTGAACTTGTTCGCCAACTCGAGTTGGCGAACAAGTTCACGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024038
VALIDATED
C19orf43 MISSION shRNA Lentiviral Transduction Particles
chromosome 19 open reading frame 43
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000455027    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024038.2-393s21c1
Sequence:CCGGCACTTAGCTTCGTGGGCAAACCTCGAGGTTTGCCCACGAAGCTAAGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074483    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024038.2-762s1c1
Sequence:CCGGGCCTCGTGAGACTTCATAGAACTCGAGTTCTATGAAGTCTCACGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024038.2-471s1c1
Sequence:CCGGCGGAGGATGAGGTATTAACAACTCGAGTTGTTAATACCTCATCCTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074487    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024038.2-442s1c1
Sequence:CCGGGACGGGAATAGTAGCCAAGAACTCGAGTTCTTGGCTACTATTCCCGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024038.2-468s1c1
Sequence:CCGGAGACGGAGGATGAGGTATTAACTCGAGTTAATACCTCATCCTCCGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437696    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024038.2-259s21c1
Sequence:CCGGGCTGTTCAAGCGGAAGATGGACTCGAGTCCATCTTCCGCTTGAACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428321    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024038.2-482s21c1
Sequence:CCGGGTATTAACAAGTAAAGGTGACCTCGAGGTCACCTTTACTTGTTAATACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000222577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024038.2-220s1c2
Sequence:CCGGCGGCGTGAACTTGTTCGCCAACTCGAGTTGGCGAACAAGTTCACGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)