EMAIL THIS PAGE TO A FRIEND

C19orf44

chromosome 19 open reading frame 44

55 Gene Product Result for
UniProtKB ID: Q9H6X5, Q8N6Y7
Gene ID:
chicken(420145) chromosome 28 open reading frame, human C19orf44
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032207 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032207 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032207 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU002161 MISSION® esiRNA esiRNA targeting human C19orf44 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032207 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032207 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00359505 predicted 1217
2 SASI_Hs01_00051359 predicted 1778
3 SASI_Hs01_00051360 predicted 1125
4 SASI_Hs02_00359506 predicted 1215
5 SASI_Hs01_00051361 predicted 1972
6 SASI_Hs01_00051362 predicted 1596
7 SASI_Hs01_00051363 predicted 230
8 SASI_Hs01_00051364 predicted 2112
9 SASI_Hs01_00051365 predicted 2102
10 SASI_Hs01_00051366 predicted 399
11 SASI_Hs01_00051358 predicted 1173
12 SASI_Hs01_00051367 predicted 2092
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032207
C19orf44 MISSION shRNA Bacterial Glycerol Stock
chromosome 19 open reading frame 44
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000263465    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032207.2-1768s21c1
Sequence:CCGGACCCATCGCCAATCATGTTATCTCGAGATAACATGATTGGCGATGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263462    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032207.2-1192s21c1
Sequence:CCGGTGTCAGTGAGAACTCCGATTTCTCGAGAAATCGGAGTTCTCACTGACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263463    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032207.2-2061s21c1
Sequence:CCGGGAGCTTGACGTGACGTCTTAACTCGAGTTAAGACGTCACGTCAAGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263464    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032207.2-1468s21c1
Sequence:CCGGCTCAGCTTATTCGGAGGATTTCTCGAGAAATCCTCCGAATAAGCTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263461    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032207.2-1134s21c1
Sequence:CCGGATGACAGCCTCGACGAGTTTACTCGAGTAAACTCGTCGAGGCTGTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173099    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032207.1-508s1c1
Sequence:CCGGCAGAATCAAGCCCGTGAACTTCTCGAGAAGTTCACGGGCTTGATTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167993    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032207.1-1122s1c1
Sequence:CCGGCCTCGACGAGTTTAGAATAAACTCGAGTTTATTCTAAACTCGTCGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032207
C19orf44 MISSION shRNA shRNA Plasmid DNA
chromosome 19 open reading frame 44
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000263465    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032207.2-1768s21c1
Sequence:CCGGACCCATCGCCAATCATGTTATCTCGAGATAACATGATTGGCGATGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263462    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032207.2-1192s21c1
Sequence:CCGGTGTCAGTGAGAACTCCGATTTCTCGAGAAATCGGAGTTCTCACTGACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263463    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032207.2-2061s21c1
Sequence:CCGGGAGCTTGACGTGACGTCTTAACTCGAGTTAAGACGTCACGTCAAGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263464    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032207.2-1468s21c1
Sequence:CCGGCTCAGCTTATTCGGAGGATTTCTCGAGAAATCCTCCGAATAAGCTGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263461    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032207.2-1134s21c1
Sequence:CCGGATGACAGCCTCGACGAGTTTACTCGAGTAAACTCGTCGAGGCTGTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173099    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032207.1-508s1c1
Sequence:CCGGCAGAATCAAGCCCGTGAACTTCTCGAGAAGTTCACGGGCTTGATTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167993    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032207.1-1122s1c1
Sequence:CCGGCCTCGACGAGTTTAGAATAAACTCGAGTTTATTCTAAACTCGTCGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032207
C19orf44 MISSION shRNA Lentiviral Transduction Particles
chromosome 19 open reading frame 44
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000263465    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032207.2-1768s21c1
Sequence:CCGGACCCATCGCCAATCATGTTATCTCGAGATAACATGATTGGCGATGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263462    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032207.2-1192s21c1
Sequence:CCGGTGTCAGTGAGAACTCCGATTTCTCGAGAAATCGGAGTTCTCACTGACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263463    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032207.2-2061s21c1
Sequence:CCGGGAGCTTGACGTGACGTCTTAACTCGAGTTAAGACGTCACGTCAAGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263464    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032207.2-1468s21c1
Sequence:CCGGCTCAGCTTATTCGGAGGATTTCTCGAGAAATCCTCCGAATAAGCTGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263461    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032207.2-1134s21c1
Sequence:CCGGATGACAGCCTCGACGAGTTTACTCGAGTAAACTCGTCGAGGCTGTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173099    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032207.1-508s1c1
Sequence:CCGGCAGAATCAAGCCCGTGAACTTCTCGAGAAGTTCACGGGCTTGATTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167993    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032207.1-1122s1c1
Sequence:CCGGCCTCGACGAGTTTAGAATAAACTCGAGTTTATTCTAAACTCGTCGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)