EMAIL THIS PAGE TO A FRIEND

C19orf45

chromosome 19 open reading frame 45

20 Gene Product Result for
Species: Human C19orf45(374877)
UniProtKB ID: Q8NA69, Q8N115
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198534 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198534 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198534 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_198534 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198534 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00212002 predicted 1181
2 SASI_Hs02_00372124 predicted 707
3 SASI_Hs01_00212003 predicted 954
4 SASI_Hs01_00212004 predicted 901
5 SASI_Hs01_00212005 predicted 1063
6 SASI_Hs02_00372125 predicted 1189
7 SASI_Hs01_00212006 predicted 1010
8 SASI_Hs01_00212007 predicted 1329
9 SASI_Hs02_00372126 predicted 1175
10 SASI_Hs01_00212008 predicted 1260
11 SASI_Hs01_00212001 predicted 807
12 SASI_Hs01_00212009 predicted 715
13 SASI_Hs01_00212010 predicted 702
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198534
C19orf45 MISSION shRNA Bacterial Glycerol Stock
chromosome 19 open reading frame 45
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000168608    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198534.1-1187s1c1
Sequence:CCGGGCTACTCAAACGCTTCTTCAACTCGAGTTGAAGAAGCGTTTGAGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167228    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198534.1-908s1c1
Sequence:CCGGCCACATCCACTGTGTAAATATCTCGAGATATTTACACAGTGGATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198534.1-1005s1c1
Sequence:CCGGGTTCTTCACCACGATCAGACTCTCGAGAGTCTGATCGTGGTGAAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198534.1-1031s1c1
Sequence:CCGGGTCGCACATCCTGAAAGGAAACTCGAGTTTCCTTTCAGGATGTGCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198534.1-872s1c1
Sequence:CCGGGCCTGAAGATAGGTATGACAACTCGAGTTGTCATACCTATCTTCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198534.1-717s1c1
Sequence:CCGGGATGGGACTTCCTACCAAAGACTCGAGTCTTTGGTAGGAAGTCCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198534.2-1217s21c1
Sequence:CCGGGGGAGCCAAAGCTACTCAAACCTCGAGGTTTGAGTAGCTTTGGCTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416623    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198534.2-728s21c1
Sequence:CCGGACACCCTCAAGTGGGACTACACTCGAGTGTAGTCCCACTTGAGGGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421206    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198534.2-1422s21c1
Sequence:CCGGGATGCTACAGCGGTGCAAGTACTCGAGTACTTGCACCGCTGTAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426015    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198534.2-1487s21c1
Sequence:CCGGCACAATACAAGGACGAGTTTCCTCGAGGAAACTCGTCCTTGTATTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198534.2-1119s21c1
Sequence:CCGCCACCTTCATGCAGTACTTCTACTCGAGTAGAAGTACTGCATGAAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198534
C19orf45 MISSION shRNA shRNA Plasmid DNA
chromosome 19 open reading frame 45
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000168608    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198534.1-1187s1c1
Sequence:CCGGGCTACTCAAACGCTTCTTCAACTCGAGTTGAAGAAGCGTTTGAGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167228    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198534.1-908s1c1
Sequence:CCGGCCACATCCACTGTGTAAATATCTCGAGATATTTACACAGTGGATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198534.1-1005s1c1
Sequence:CCGGGTTCTTCACCACGATCAGACTCTCGAGAGTCTGATCGTGGTGAAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198534.1-1031s1c1
Sequence:CCGGGTCGCACATCCTGAAAGGAAACTCGAGTTTCCTTTCAGGATGTGCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198534.1-872s1c1
Sequence:CCGGGCCTGAAGATAGGTATGACAACTCGAGTTGTCATACCTATCTTCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198534.1-717s1c1
Sequence:CCGGGATGGGACTTCCTACCAAAGACTCGAGTCTTTGGTAGGAAGTCCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198534.2-1217s21c1
Sequence:CCGGGGGAGCCAAAGCTACTCAAACCTCGAGGTTTGAGTAGCTTTGGCTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416623    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198534.2-728s21c1
Sequence:CCGGACACCCTCAAGTGGGACTACACTCGAGTGTAGTCCCACTTGAGGGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421206    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198534.2-1422s21c1
Sequence:CCGGGATGCTACAGCGGTGCAAGTACTCGAGTACTTGCACCGCTGTAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426015    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198534.2-1487s21c1
Sequence:CCGGCACAATACAAGGACGAGTTTCCTCGAGGAAACTCGTCCTTGTATTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198534.2-1119s21c1
Sequence:CCGCCACCTTCATGCAGTACTTCTACTCGAGTAGAAGTACTGCATGAAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198534
C19orf45 MISSION shRNA Lentiviral Transduction Particles
chromosome 19 open reading frame 45
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000168608    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198534.1-1187s1c1
Sequence:CCGGGCTACTCAAACGCTTCTTCAACTCGAGTTGAAGAAGCGTTTGAGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167228    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198534.1-908s1c1
Sequence:CCGGCCACATCCACTGTGTAAATATCTCGAGATATTTACACAGTGGATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198534.1-1005s1c1
Sequence:CCGGGTTCTTCACCACGATCAGACTCTCGAGAGTCTGATCGTGGTGAAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198534.1-1031s1c1
Sequence:CCGGGTCGCACATCCTGAAAGGAAACTCGAGTTTCCTTTCAGGATGTGCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198534.1-872s1c1
Sequence:CCGGGCCTGAAGATAGGTATGACAACTCGAGTTGTCATACCTATCTTCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198534.1-717s1c1
Sequence:CCGGGATGGGACTTCCTACCAAAGACTCGAGTCTTTGGTAGGAAGTCCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198534.2-1217s21c1
Sequence:CCGGGGGAGCCAAAGCTACTCAAACCTCGAGGTTTGAGTAGCTTTGGCTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416623    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198534.2-728s21c1
Sequence:CCGGACACCCTCAAGTGGGACTACACTCGAGTGTAGTCCCACTTGAGGGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421206    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198534.2-1422s21c1
Sequence:CCGGGATGCTACAGCGGTGCAAGTACTCGAGTACTTGCACCGCTGTAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426015    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198534.2-1487s21c1
Sequence:CCGGCACAATACAAGGACGAGTTTCCTCGAGGAAACTCGTCCTTGTATTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198534.2-1119s21c1
Sequence:CCGCCACCTTCATGCAGTACTTCTACTCGAGTAGAAGTACTGCATGAAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks