EMAIL THIS PAGE TO A FRIEND

C19orf47

chromosome 19 open reading frame 47

56 Gene Product Result for
Species: Human C19orf47(126526)
UniProtKB ID: Q8N9M1, Q8IZ33, Q8N0V9
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178830 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_178830 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_178830 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU091211 MISSION® esiRNA esiRNA human C19orf47 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_178830 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178830 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00210299 predicted 546
2 SASI_Hs01_00210300 predicted 800
3 SASI_Hs01_00210301 predicted 563
4 SASI_Hs01_00210302 predicted 335
5 SASI_Hs01_00210303 predicted 274
6 SASI_Hs01_00210304 predicted 740
7 SASI_Hs02_00369879 predicted 369
8 SASI_Hs01_00210305 predicted 321
9 SASI_Hs01_00210306 predicted 330
10 SASI_Hs01_00210307 predicted 1074
11 SASI_Hs01_00210308 predicted 536
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178830
C19orf47 MISSION shRNA Bacterial Glycerol Stock
chromosome 19 open reading frame 47
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000231829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178830.2-268s21c1
Sequence:CCGGGCATGCTGCTGGATCTCAATACTCGAGTATTGAGATCCAGCAGCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231832    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178830.2-1176s21c1
Sequence:CCGGGAGGTCAAGGTCACCATTAAGCTCGAGCTTAATGGTGACCTTGACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231833    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178830.2-1783s21c1
Sequence:CCGGTCTCTCCCTGTCTTCACTTTGCTCGAGCAAAGTGAAGACAGGGAGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231831    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178830.2-1066s21c1
Sequence:CCGGAGCCGGAGTCCTTGTCTAAAGCTCGAGCTTTAGACAAGGACTCCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178830.2-793s21c1
Sequence:CCGGACACCACGACAGGGAGTAAACCTCGAGGTTTACTCCCTGTCGTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178830
C19orf47 MISSION shRNA shRNA Plasmid DNA
chromosome 19 open reading frame 47
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000231829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178830.2-268s21c1
Sequence:CCGGGCATGCTGCTGGATCTCAATACTCGAGTATTGAGATCCAGCAGCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231832    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178830.2-1176s21c1
Sequence:CCGGGAGGTCAAGGTCACCATTAAGCTCGAGCTTAATGGTGACCTTGACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231833    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178830.2-1783s21c1
Sequence:CCGGTCTCTCCCTGTCTTCACTTTGCTCGAGCAAAGTGAAGACAGGGAGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231831    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178830.2-1066s21c1
Sequence:CCGGAGCCGGAGTCCTTGTCTAAAGCTCGAGCTTTAGACAAGGACTCCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178830.2-793s21c1
Sequence:CCGGACACCACGACAGGGAGTAAACCTCGAGGTTTACTCCCTGTCGTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178830
C19orf47 MISSION shRNA Lentiviral Transduction Particles
chromosome 19 open reading frame 47
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000231829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178830.2-268s21c1
Sequence:CCGGGCATGCTGCTGGATCTCAATACTCGAGTATTGAGATCCAGCAGCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231832    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178830.2-1176s21c1
Sequence:CCGGGAGGTCAAGGTCACCATTAAGCTCGAGCTTAATGGTGACCTTGACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231833    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178830.2-1783s21c1
Sequence:CCGGTCTCTCCCTGTCTTCACTTTGCTCGAGCAAAGTGAAGACAGGGAGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231831    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178830.2-1066s21c1
Sequence:CCGGAGCCGGAGTCCTTGTCTAAAGCTCGAGCTTTAGACAAGGACTCCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178830.2-793s21c1
Sequence:CCGGACACCACGACAGGGAGTAAACCTCGAGGTTTACTCCCTGTCGTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks