EMAIL THIS PAGE TO A FRIEND

C19orf48

chromosome 19 open reading frame 48

Species: Human C19orf48(84798)
UniProtKB ID: Q6RUI8
Gene ID:
26 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA042000 Anti-C19orf48 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_199250 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_199250 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_199250 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU098151 MISSION® esiRNA esiRNA human C19orf48 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_199249 Rosetta Predictions human pricing
NM_199250 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199249 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00171533 predicted 1067
2 SASI_Hs01_00171534 predicted 1031
3 SASI_Hs01_00171535 predicted 1336
4 SASI_Hs01_00171536 predicted 1369
5 SASI_Hs01_00171537 predicted 1021
6 SASI_Hs01_00171538 predicted 1004
7 SASI_Hs01_00171539 predicted 1004
8 SASI_Hs01_00171540 predicted 1158
9 SASI_Hs01_00171541 predicted 1263
10 SASI_Hs01_00171542 predicted 1129
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199250 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00131819 predicted 903
2 SASI_Hs01_00131820 predicted 869
3 SASI_Hs01_00131821 predicted 1171
4 SASI_Hs01_00131822 predicted 1206
5 SASI_Hs01_00131823 predicted 850
6 SASI_Hs01_00131824 predicted 841
7 SASI_Hs01_00131825 predicted 842
8 SASI_Hs01_00131826 predicted 991
9 SASI_Hs01_00131827 predicted 1103
10 SASI_Hs01_00131828 predicted 961
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_199250
VALIDATED
C19orf48 MISSION shRNA Bacterial Glycerol Stock
chromosome 19 open reading frame 48
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000293769    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_199250.1-1118s21c1
Sequence:CCGGCATTCAGGAAGTGCGGGACATCTCGAGATGTCCCGCACTTCCTGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293714    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_199250.1-1275s21c1
Sequence:CCGGGTCACTGGCCAGATGTCATGACTCGAGTCATGACATCTGGCCAGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286579    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_199250.1-1352s21c1
Sequence:CCGGCCAGGCATCGTGTGCCATGTTCTCGAGAACATGGCACACGATGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293713    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_199250.1-1310s21c1
Sequence:CCGGGTGAGTGGACACTGACCATGACTCGAGTCATGGTCAGTGTCCACTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293770    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_199250.1-1207s21c1
Sequence:CCGGCACACCCTGACACCATGTTCACTCGAGTGAACATGGTGTCAGGGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072743    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_199250.1-1352s1c1
Sequence:CCGGCCAGGCATCGTGTGCCATGTTCTCGAGAACATGGCACACGATGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199250.1-970s1c1
Sequence:CCGGCCCTATTGTGACCAGGCCTATCTCGAGATAGGCCTGGTCACAATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_199250.1-867s1c1
Sequence:CCGGCCAGTGCACAAGGACTTGGCTCTCGAGAGCCAAGTCCTTGTGCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199250.1-907s1c1
Sequence:CCGGAGAAGGTGGATAAGTGGGCTACTCGAGTAGCCCACTTATCCACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_199250
VALIDATED
C19orf48 MISSION shRNA shRNA Plasmid DNA
chromosome 19 open reading frame 48
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000293769    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_199250.1-1118s21c1
Sequence:CCGGCATTCAGGAAGTGCGGGACATCTCGAGATGTCCCGCACTTCCTGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293714    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_199250.1-1275s21c1
Sequence:CCGGGTCACTGGCCAGATGTCATGACTCGAGTCATGACATCTGGCCAGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286579    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_199250.1-1352s21c1
Sequence:CCGGCCAGGCATCGTGTGCCATGTTCTCGAGAACATGGCACACGATGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293713    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_199250.1-1310s21c1
Sequence:CCGGGTGAGTGGACACTGACCATGACTCGAGTCATGGTCAGTGTCCACTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293770    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_199250.1-1207s21c1
Sequence:CCGGCACACCCTGACACCATGTTCACTCGAGTGAACATGGTGTCAGGGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072743    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_199250.1-1352s1c1
Sequence:CCGGCCAGGCATCGTGTGCCATGTTCTCGAGAACATGGCACACGATGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199250.1-970s1c1
Sequence:CCGGCCCTATTGTGACCAGGCCTATCTCGAGATAGGCCTGGTCACAATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_199250.1-867s1c1
Sequence:CCGGCCAGTGCACAAGGACTTGGCTCTCGAGAGCCAAGTCCTTGTGCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199250.1-907s1c1
Sequence:CCGGAGAAGGTGGATAAGTGGGCTACTCGAGTAGCCCACTTATCCACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_199250
VALIDATED
C19orf48 MISSION shRNA Lentiviral Transduction Particles
chromosome 19 open reading frame 48
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000293769    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_199250.1-1118s21c1
Sequence:CCGGCATTCAGGAAGTGCGGGACATCTCGAGATGTCCCGCACTTCCTGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293714    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_199250.1-1275s21c1
Sequence:CCGGGTCACTGGCCAGATGTCATGACTCGAGTCATGACATCTGGCCAGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286579    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_199250.1-1352s21c1
Sequence:CCGGCCAGGCATCGTGTGCCATGTTCTCGAGAACATGGCACACGATGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293713    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_199250.1-1310s21c1
Sequence:CCGGGTGAGTGGACACTGACCATGACTCGAGTCATGGTCAGTGTCCACTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293770    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_199250.1-1207s21c1
Sequence:CCGGCACACCCTGACACCATGTTCACTCGAGTGAACATGGTGTCAGGGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072743    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_199250.1-1352s1c1
Sequence:CCGGCCAGGCATCGTGTGCCATGTTCTCGAGAACATGGCACACGATGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199250.1-970s1c1
Sequence:CCGGCCCTATTGTGACCAGGCCTATCTCGAGATAGGCCTGGTCACAATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_199250.1-867s1c1
Sequence:CCGGCCAGTGCACAAGGACTTGGCTCTCGAGAGCCAAGTCCTTGTGCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199250.1-907s1c1
Sequence:CCGGAGAAGGTGGATAAGTGGGCTACTCGAGTAGCCCACTTATCCACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks