EMAIL THIS PAGE TO A FRIEND

C19orf52

chromosome 19 open reading frame 52

19 Gene Product Result for
Species: Human C19orf52(90580)
UniProtKB ID: Q9BSF4, Q96EY6, Q96IT8
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_138358 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138358 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138358 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU004331 MISSION® esiRNA esiRNA targeting human C19orf52 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_138358 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138358 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00220642 predicted 939
2 SASI_Hs01_00220643 predicted 698
3 SASI_Hs01_00220644 predicted 708
4 SASI_Hs01_00220645 predicted 704
5 SASI_Hs01_00220646 predicted 615
6 SASI_Hs01_00220647 predicted 616
7 SASI_Hs01_00220648 predicted 996
8 SASI_Hs01_00220649 predicted 924
9 SASI_Hs01_00220650 predicted 927
10 SASI_Hs01_00220651 predicted 676
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138358
C19orf52 MISSION shRNA Bacterial Glycerol Stock
chromosome 19 open reading frame 52
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000168471    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138358.2-1180s1c1
Sequence:CCGGGCTGACTTGCAAACTCTTCTACTCGAGTAGAAGAGTTTGCAAGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168286    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138358.2-708s1c1
Sequence:CCGGGCTCTTCGATGAGAAGTACAACTCGAGTTGTACTTCTCATCGAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167924    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138358.2-1193s1c1
Sequence:CCGGCTCTTCTAAGGCCACTTAGATCTCGAGATCTAAGTGGCCTTAGAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168016    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138358.2-1069s1c1
Sequence:CCGGCAGAACGACTTGACACATGTTCTCGAGAACATGTGTCAAGTCGTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168081    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138358.2-937s1c1
Sequence:CCGGCTGAGACAGATGATGTGCAAACTCGAGTTTGCACATCATCTGTCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438534    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138358.2-907s21c1
Sequence:CCGGAGTTCTGAGTGTGCCTCACCTCTCGAGAGGTGAGGCACACTCAGAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425967    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138358.2-1011s21c1
Sequence:CCGGTTGTTCTTTATTAGCTGAAGCCTCGAGGCTTCAGCTAATAAAGAACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415550    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138358.2-1242s21c1
Sequence:CCGGGGCATGGTGATGTCTGTAATCCTCGAGGATTACAGACATCACCATGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138358
C19orf52 MISSION shRNA shRNA Plasmid DNA
chromosome 19 open reading frame 52
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000168471    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138358.2-1180s1c1
Sequence:CCGGGCTGACTTGCAAACTCTTCTACTCGAGTAGAAGAGTTTGCAAGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168286    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138358.2-708s1c1
Sequence:CCGGGCTCTTCGATGAGAAGTACAACTCGAGTTGTACTTCTCATCGAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167924    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138358.2-1193s1c1
Sequence:CCGGCTCTTCTAAGGCCACTTAGATCTCGAGATCTAAGTGGCCTTAGAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168016    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138358.2-1069s1c1
Sequence:CCGGCAGAACGACTTGACACATGTTCTCGAGAACATGTGTCAAGTCGTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168081    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138358.2-937s1c1
Sequence:CCGGCTGAGACAGATGATGTGCAAACTCGAGTTTGCACATCATCTGTCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438534    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138358.2-907s21c1
Sequence:CCGGAGTTCTGAGTGTGCCTCACCTCTCGAGAGGTGAGGCACACTCAGAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425967    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138358.2-1011s21c1
Sequence:CCGGTTGTTCTTTATTAGCTGAAGCCTCGAGGCTTCAGCTAATAAAGAACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415550    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138358.2-1242s21c1
Sequence:CCGGGGCATGGTGATGTCTGTAATCCTCGAGGATTACAGACATCACCATGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138358
C19orf52 MISSION shRNA Lentiviral Transduction Particles
chromosome 19 open reading frame 52
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000168471    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138358.2-1180s1c1
Sequence:CCGGGCTGACTTGCAAACTCTTCTACTCGAGTAGAAGAGTTTGCAAGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168286    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138358.2-708s1c1
Sequence:CCGGGCTCTTCGATGAGAAGTACAACTCGAGTTGTACTTCTCATCGAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167924    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138358.2-1193s1c1
Sequence:CCGGCTCTTCTAAGGCCACTTAGATCTCGAGATCTAAGTGGCCTTAGAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168016    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138358.2-1069s1c1
Sequence:CCGGCAGAACGACTTGACACATGTTCTCGAGAACATGTGTCAAGTCGTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168081    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138358.2-937s1c1
Sequence:CCGGCTGAGACAGATGATGTGCAAACTCGAGTTTGCACATCATCTGTCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438534    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138358.2-907s21c1
Sequence:CCGGAGTTCTGAGTGTGCCTCACCTCTCGAGAGGTGAGGCACACTCAGAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425967    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138358.2-1011s21c1
Sequence:CCGGTTGTTCTTTATTAGCTGAAGCCTCGAGGCTTCAGCTAATAAAGAACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415550    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138358.2-1242s21c1
Sequence:CCGGGGCATGGTGATGTCTGTAATCCTCGAGGATTACAGACATCACCATGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks