EMAIL THIS PAGE TO A FRIEND

C19orf53

chromosome 19 open reading frame 53

25 Gene Product Result for
Synonyms: LYDG10
Species: Human C19orf53(28974)
UniProtKB ID: Q9UNZ5, B2R4J9
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014047 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014047 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014047 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU034861 MISSION® esiRNA esiRNA human C19orf53 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014047 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014047 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00238962 predicted 506
2 SASI_Hs01_00238963 predicted 381
3 SASI_Hs02_00345047 predicted 498
4 SASI_Hs01_00238964 predicted 430
5 SASI_Hs01_00238965 predicted 199
6 SASI_Hs02_00345048 predicted 212
7 SASI_Hs02_00345049 predicted 572
8 SASI_Hs02_00345050 predicted 412
9 SASI_Hs02_00345051 predicted 192
10 SASI_Hs02_00345052 predicted 554
11 SASI_Hs01_00238956 predicted 345
12 SASI_Hs01_00238957 predicted 357
13 SASI_Hs01_00238958 predicted 348
14 SASI_Hs01_00238959 predicted 218
15 SASI_Hs01_00238960 predicted 197
16 SASI_Hs01_00238961 predicted 467
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014047
VALIDATED
C19orf53 MISSION shRNA Bacterial Glycerol Stock
chromosome 19 open reading frame 53
Human
17 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000280961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_014047.2-179s21c1
Sequence:CCGGGCTCAAGAAGAACCTAGAAGTCTCGAGACTTCTAGGTTCTTCTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280894    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_014047.2-490s21c1
Sequence:CCGGCCAGCAATGACCAGGAAGATACTCGAGTATCTTCCTGGTCATTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_014047.2-65s21c1
Sequence:CCGGGCACAAACCCGCAAAGAGTAACTCGAGTTACTCTTTGCGGGTTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_014047.2-219s21c1
Sequence:CCGGGAACATGACGTGGTGATGAAACTCGAGTTTCATCACCACGTCATGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280893    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_014047.2-206s21c1
Sequence:CCGGCCGGAAGAAGATCGAACATGACTCGAGTCATGTTCGATCTTCTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166248    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014047.1-464s1c1
Sequence:CCGGCCAGCAATGACCAGGAAGATACTCGAGTATCTTCCTGGTCATTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165543    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014047.1-176s1c1
Sequence:CCGGGAATCCGGAAGAAGATCGAACCTCGAGGTTCGATCTTCTTCCGGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162970    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014047.1-193s1c1
Sequence:CCGGGAACATGACGTGGTGATGAAACTCGAGTTTCATCACCACGTCATGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163016    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014047.1-159s1c1
Sequence:CCGGGAAGAACCTAGAAGTCGGAATCTCGAGATTCCGACTTCTAGGTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163171    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014047.1-183s1c1
Sequence:CCGGGAAGAAGATCGAACATGACGTCTCGAGACGTCATGTTCGATCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163280    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014047.1-153s1c1
Sequence:CCGGGCTCAAGAAGAACCTAGAAGTCTCGAGACTTCTAGGTTCTTCTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164493    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014047.1-154s1c1
Sequence:CCGGCTCAAGAAGAACCTAGAAGTCCTCGAGGACTTCTAGGTTCTTCTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164705    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014047.1-192s1c1
Sequence:CCGGCGAACATGACGTGGTGATGAACTCGAGTTCATCACCACGTCATGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164893    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014047.1-186s1c1
Sequence:CCGGGAAGATCGAACATGACGTGGTCTCGAGACCACGTCATGTTCGATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164987    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014047.1-39s1c1
Sequence:CCGGGCACAAACCCGCAAAGAGTAACTCGAGTTACTCTTTGCGGGTTTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165318    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014047.1-189s1c1
Sequence:CCGGGATCGAACATGACGTGGTGATCTCGAGATCACCACGTCATGTTCGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165694    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014047.1-180s1c1
Sequence:CCGGCCGGAAGAAGATCGAACATGACTCGAGTCATGTTCGATCTTCTTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014047
VALIDATED
C19orf53 MISSION shRNA shRNA Plasmid DNA
chromosome 19 open reading frame 53
Human
17 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000280961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_014047.2-179s21c1
Sequence:CCGGGCTCAAGAAGAACCTAGAAGTCTCGAGACTTCTAGGTTCTTCTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280894    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_014047.2-490s21c1
Sequence:CCGGCCAGCAATGACCAGGAAGATACTCGAGTATCTTCCTGGTCATTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_014047.2-65s21c1
Sequence:CCGGGCACAAACCCGCAAAGAGTAACTCGAGTTACTCTTTGCGGGTTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_014047.2-219s21c1
Sequence:CCGGGAACATGACGTGGTGATGAAACTCGAGTTTCATCACCACGTCATGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280893    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_014047.2-206s21c1
Sequence:CCGGCCGGAAGAAGATCGAACATGACTCGAGTCATGTTCGATCTTCTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166248    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014047.1-464s1c1
Sequence:CCGGCCAGCAATGACCAGGAAGATACTCGAGTATCTTCCTGGTCATTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165543    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014047.1-176s1c1
Sequence:CCGGGAATCCGGAAGAAGATCGAACCTCGAGGTTCGATCTTCTTCCGGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162970    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014047.1-193s1c1
Sequence:CCGGGAACATGACGTGGTGATGAAACTCGAGTTTCATCACCACGTCATGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163016    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014047.1-159s1c1
Sequence:CCGGGAAGAACCTAGAAGTCGGAATCTCGAGATTCCGACTTCTAGGTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163171    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014047.1-183s1c1
Sequence:CCGGGAAGAAGATCGAACATGACGTCTCGAGACGTCATGTTCGATCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163280    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014047.1-153s1c1
Sequence:CCGGGCTCAAGAAGAACCTAGAAGTCTCGAGACTTCTAGGTTCTTCTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164493    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014047.1-154s1c1
Sequence:CCGGCTCAAGAAGAACCTAGAAGTCCTCGAGGACTTCTAGGTTCTTCTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164705    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014047.1-192s1c1
Sequence:CCGGCGAACATGACGTGGTGATGAACTCGAGTTCATCACCACGTCATGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164893    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014047.1-186s1c1
Sequence:CCGGGAAGATCGAACATGACGTGGTCTCGAGACCACGTCATGTTCGATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164987    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014047.1-39s1c1
Sequence:CCGGGCACAAACCCGCAAAGAGTAACTCGAGTTACTCTTTGCGGGTTTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165318    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014047.1-189s1c1
Sequence:CCGGGATCGAACATGACGTGGTGATCTCGAGATCACCACGTCATGTTCGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165694    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014047.1-180s1c1
Sequence:CCGGCCGGAAGAAGATCGAACATGACTCGAGTCATGTTCGATCTTCTTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014047
VALIDATED
C19orf53 MISSION shRNA Lentiviral Transduction Particles
chromosome 19 open reading frame 53
Human
17 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000280961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_014047.2-179s21c1
Sequence:CCGGGCTCAAGAAGAACCTAGAAGTCTCGAGACTTCTAGGTTCTTCTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280894    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_014047.2-490s21c1
Sequence:CCGGCCAGCAATGACCAGGAAGATACTCGAGTATCTTCCTGGTCATTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_014047.2-65s21c1
Sequence:CCGGGCACAAACCCGCAAAGAGTAACTCGAGTTACTCTTTGCGGGTTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_014047.2-219s21c1
Sequence:CCGGGAACATGACGTGGTGATGAAACTCGAGTTTCATCACCACGTCATGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280893    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_014047.2-206s21c1
Sequence:CCGGCCGGAAGAAGATCGAACATGACTCGAGTCATGTTCGATCTTCTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166248    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014047.1-464s1c1
Sequence:CCGGCCAGCAATGACCAGGAAGATACTCGAGTATCTTCCTGGTCATTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165543    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014047.1-176s1c1
Sequence:CCGGGAATCCGGAAGAAGATCGAACCTCGAGGTTCGATCTTCTTCCGGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162970    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014047.1-193s1c1
Sequence:CCGGGAACATGACGTGGTGATGAAACTCGAGTTTCATCACCACGTCATGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163016    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014047.1-159s1c1
Sequence:CCGGGAAGAACCTAGAAGTCGGAATCTCGAGATTCCGACTTCTAGGTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163171    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014047.1-183s1c1
Sequence:CCGGGAAGAAGATCGAACATGACGTCTCGAGACGTCATGTTCGATCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163280    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014047.1-153s1c1
Sequence:CCGGGCTCAAGAAGAACCTAGAAGTCTCGAGACTTCTAGGTTCTTCTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164493    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014047.1-154s1c1
Sequence:CCGGCTCAAGAAGAACCTAGAAGTCCTCGAGGACTTCTAGGTTCTTCTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164705    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014047.1-192s1c1
Sequence:CCGGCGAACATGACGTGGTGATGAACTCGAGTTCATCACCACGTCATGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164893    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014047.1-186s1c1
Sequence:CCGGGAAGATCGAACATGACGTGGTCTCGAGACCACGTCATGTTCGATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164987    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014047.1-39s1c1
Sequence:CCGGGCACAAACCCGCAAAGAGTAACTCGAGTTACTCTTTGCGGGTTTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165318    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014047.1-189s1c1
Sequence:CCGGGATCGAACATGACGTGGTGATCTCGAGATCACCACGTCATGTTCGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165694    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014047.1-180s1c1
Sequence:CCGGCCGGAAGAAGATCGAACATGACTCGAGTCATGTTCGATCTTCTTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks