EMAIL THIS PAGE TO A FRIEND

C19orf54

chromosome 19 open reading frame 54

30 Gene Product Result for
Species: Human C19orf54(284325)
UniProtKB ID: Q5BKX5, A8MSZ5, B4DNU7
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198476 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198476 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198476 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU019101 MISSION® esiRNA esiRNA targeting human C19orf54 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_198476 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198476 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00372009 predicted 1196
2 SASI_Hs02_00372010 predicted 1207
3 SASI_Hs02_00372011 predicted 1194
4 SASI_Hs02_00372012 predicted 1331
5 SASI_Hs01_00069303 predicted 618
6 SASI_Hs02_00372013 predicted 1399
7 SASI_Hs02_00372014 predicted 1516
8 SASI_Hs02_00372015 predicted 1539
9 SASI_Hs02_00372016 predicted 447
10 SASI_Hs02_00372017 predicted 994
11 SASI_Hs01_00069302 predicted 521
12 SASI_Hs01_00069304 predicted 770
13 SASI_Hs01_00069305 predicted 602
14 SASI_Hs01_00069306 predicted 506
15 SASI_Hs01_00069307 predicted 749
16 SASI_Hs01_00069308 predicted 667
17 SASI_Hs01_00069309 predicted 516
18 SASI_Hs01_00069310 predicted 705
19 SASI_Hs01_00069311 predicted 516
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198476
VALIDATED
C19orf54 MISSION shRNA Bacterial Glycerol Stock
chromosome 19 open reading frame 54
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166755    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198476.1-1358s1c1
Sequence:CCGGCGAACTCCTGACCTTGAGTAACTCGAGTTACTCAAGGTCAGGAGTTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163440    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198476.1-1359s1c1
Sequence:CCGGGAACTCCTGACCTTGAGTAATCTCGAGATTACTCAAGGTCAGGAGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161926    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198476.1-1444s1c1
Sequence:CCGGGCAGTATTTCTAACCAGTGATCTCGAGATCACTGGTTAGAAATACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163649    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198476.1-1436s1c1
Sequence:CCGGGCCACAGTGCAGTATTTCTAACTCGAGTTAGAAATACTGCACTGTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166165    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198476.1-1568s1c1
Sequence:CCGGCCCTGCATTGTAACACATCCACTCGAGTGGATGTGTTACAATGCAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165281    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198476.1-530s1c1
Sequence:CCGGGATGTTCTCAGTGGCCGATATCTCGAGATATCGGCCACTGAGAACATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165712    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198476.1-1080s1c1
Sequence:CCGGCCGATTTGACAGATGGCAAGACTCGAGTCTTGCCATCTGTCAAATCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165660    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198476.1-1132s1c1
Sequence:CCGGGAGGTCACATGACTAGCACATCTCGAGATGTGCTAGTCATGTGACCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370570    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198476.3-494s21c1
Sequence:CCGGTCATCCAAGAAGGCCCTCAATCTCGAGATTGAGGGCCTTCTTGGATGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344074    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198476.3-628s21c1
Sequence:CCGGATGTTCTCAGTGGCCGATATGCTCGAGCATATCGGCCACTGAGAACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370571    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_198476.3-1201s21c1
Sequence:CCGGGCCTAGCTCGGTAACCATTTGCTCGAGCAAATGGTTACCGAGCTAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370572    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_198476.3-418s21c1
Sequence:CCGGAGGCTTCTGAAACTACACAAGCTCGAGCTTGTGTAGTTTCAGAAGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198476.3-1155s21c1
Sequence:CCGGACCACAGGACTGCAGCCATTACTCGAGTAATGGCTGCAGTCCTGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344073    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198476.3-1429s21c1
Sequence:CCGGCTGTCATCTCACTAGACATTTCTCGAGAAATGTCTAGTGAGATGACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344072    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_198476.3-781s21c1
Sequence:CCGGTTCAACCATGAGCCGTGTCAGCTCGAGCTGACACGGCTCATGGTTGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198476
VALIDATED
C19orf54 MISSION shRNA shRNA Plasmid DNA
chromosome 19 open reading frame 54
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166755    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198476.1-1358s1c1
Sequence:CCGGCGAACTCCTGACCTTGAGTAACTCGAGTTACTCAAGGTCAGGAGTTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163440    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198476.1-1359s1c1
Sequence:CCGGGAACTCCTGACCTTGAGTAATCTCGAGATTACTCAAGGTCAGGAGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161926    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198476.1-1444s1c1
Sequence:CCGGGCAGTATTTCTAACCAGTGATCTCGAGATCACTGGTTAGAAATACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163649    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198476.1-1436s1c1
Sequence:CCGGGCCACAGTGCAGTATTTCTAACTCGAGTTAGAAATACTGCACTGTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166165    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198476.1-1568s1c1
Sequence:CCGGCCCTGCATTGTAACACATCCACTCGAGTGGATGTGTTACAATGCAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165281    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198476.1-530s1c1
Sequence:CCGGGATGTTCTCAGTGGCCGATATCTCGAGATATCGGCCACTGAGAACATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165712    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198476.1-1080s1c1
Sequence:CCGGCCGATTTGACAGATGGCAAGACTCGAGTCTTGCCATCTGTCAAATCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165660    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198476.1-1132s1c1
Sequence:CCGGGAGGTCACATGACTAGCACATCTCGAGATGTGCTAGTCATGTGACCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000370570    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198476.3-494s21c1
Sequence:CCGGTCATCCAAGAAGGCCCTCAATCTCGAGATTGAGGGCCTTCTTGGATGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344074    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198476.3-628s21c1
Sequence:CCGGATGTTCTCAGTGGCCGATATGCTCGAGCATATCGGCCACTGAGAACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000370571    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_198476.3-1201s21c1
Sequence:CCGGGCCTAGCTCGGTAACCATTTGCTCGAGCAAATGGTTACCGAGCTAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000370572    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_198476.3-418s21c1
Sequence:CCGGAGGCTTCTGAAACTACACAAGCTCGAGCTTGTGTAGTTTCAGAAGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000353035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198476.3-1155s21c1
Sequence:CCGGACCACAGGACTGCAGCCATTACTCGAGTAATGGCTGCAGTCCTGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344073    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198476.3-1429s21c1
Sequence:CCGGCTGTCATCTCACTAGACATTTCTCGAGAAATGTCTAGTGAGATGACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344072    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_198476.3-781s21c1
Sequence:CCGGTTCAACCATGAGCCGTGTCAGCTCGAGCTGACACGGCTCATGGTTGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198476
VALIDATED
C19orf54 MISSION shRNA Lentiviral Transduction Particles
chromosome 19 open reading frame 54
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166755    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198476.1-1358s1c1
Sequence:CCGGCGAACTCCTGACCTTGAGTAACTCGAGTTACTCAAGGTCAGGAGTTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163440    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198476.1-1359s1c1
Sequence:CCGGGAACTCCTGACCTTGAGTAATCTCGAGATTACTCAAGGTCAGGAGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161926    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198476.1-1444s1c1
Sequence:CCGGGCAGTATTTCTAACCAGTGATCTCGAGATCACTGGTTAGAAATACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163649    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198476.1-1436s1c1
Sequence:CCGGGCCACAGTGCAGTATTTCTAACTCGAGTTAGAAATACTGCACTGTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166165    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198476.1-1568s1c1
Sequence:CCGGCCCTGCATTGTAACACATCCACTCGAGTGGATGTGTTACAATGCAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165281    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198476.1-530s1c1
Sequence:CCGGGATGTTCTCAGTGGCCGATATCTCGAGATATCGGCCACTGAGAACATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165712    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198476.1-1080s1c1
Sequence:CCGGCCGATTTGACAGATGGCAAGACTCGAGTCTTGCCATCTGTCAAATCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165660    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198476.1-1132s1c1
Sequence:CCGGGAGGTCACATGACTAGCACATCTCGAGATGTGCTAGTCATGTGACCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370570    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198476.3-494s21c1
Sequence:CCGGTCATCCAAGAAGGCCCTCAATCTCGAGATTGAGGGCCTTCTTGGATGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344074    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198476.3-628s21c1
Sequence:CCGGATGTTCTCAGTGGCCGATATGCTCGAGCATATCGGCCACTGAGAACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370571    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_198476.3-1201s21c1
Sequence:CCGGGCCTAGCTCGGTAACCATTTGCTCGAGCAAATGGTTACCGAGCTAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370572    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_198476.3-418s21c1
Sequence:CCGGAGGCTTCTGAAACTACACAAGCTCGAGCTTGTGTAGTTTCAGAAGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198476.3-1155s21c1
Sequence:CCGGACCACAGGACTGCAGCCATTACTCGAGTAATGGCTGCAGTCCTGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344073    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198476.3-1429s21c1
Sequence:CCGGCTGTCATCTCACTAGACATTTCTCGAGAAATGTCTAGTGAGATGACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344072    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_198476.3-781s21c1
Sequence:CCGGTTCAACCATGAGCCGTGTCAGCTCGAGCTGACACGGCTCATGGTTGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)