EMAIL THIS PAGE TO A FRIEND

C19orf55

chromosome 19 open reading frame 55

38 Gene Product Result for
Species: Human C19orf55(148137)
UniProtKB ID: Q2NL68, Q8NDI3, Q8WWC8, Q96NL4
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144692 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_144692 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_144692 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001039887 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039887 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00044664 predicted 216
2 SASI_Hs01_00044665 predicted 487
3 SASI_Hs01_00044666 predicted 379
4 SASI_Hs01_00044667 predicted 568
5 SASI_Hs01_00044669 predicted 509
6 SASI_Hs01_00044670 predicted 550
7 SASI_Hs01_00044671 predicted 513
8 SASI_Hs01_00044672 predicted 546
9 SASI_Hs01_00044673 predicted 537
10 SASI_Hs02_00308708 predicted 263
11 SASI_Hs01_00044668 predicted 569
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144692
VALIDATED
C19orf55 MISSION shRNA Bacterial Glycerol Stock
chromosome 19 open reading frame 55
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000183157    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144692.1-2271s1c1
Sequence:CCGGGCCAGAAGACTTTGAATTGTACTCGAGTACAATTCAAAGTCTTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179403    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144692.1-3403s1c1
Sequence:CCGGGCTGTCTTTGACTTCTGTCTTCTCGAGAAGACAGAAGTCAAAGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179689    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144692.1-3516s1c1
Sequence:CCGGGCTGTAGTACAATGGCATGATCTCGAGATCATGCCATTGTACTACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180523    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144692.1-839s1c1
Sequence:CCGGGCCAGAGGATGACATTCTGTACTCGAGTACAGAATGTCATCCTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179989    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_144692.1-63s1c1
Sequence:CCGGCAAGATAGTCCCTTTGGAGATCTCGAGATCTCCAAAGGGACTATCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144692
VALIDATED
C19orf55 MISSION shRNA shRNA Plasmid DNA
chromosome 19 open reading frame 55
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000183157    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144692.1-2271s1c1
Sequence:CCGGGCCAGAAGACTTTGAATTGTACTCGAGTACAATTCAAAGTCTTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179403    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144692.1-3403s1c1
Sequence:CCGGGCTGTCTTTGACTTCTGTCTTCTCGAGAAGACAGAAGTCAAAGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179689    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144692.1-3516s1c1
Sequence:CCGGGCTGTAGTACAATGGCATGATCTCGAGATCATGCCATTGTACTACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180523    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144692.1-839s1c1
Sequence:CCGGGCCAGAGGATGACATTCTGTACTCGAGTACAGAATGTCATCCTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179989    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_144692.1-63s1c1
Sequence:CCGGCAAGATAGTCCCTTTGGAGATCTCGAGATCTCCAAAGGGACTATCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144692
VALIDATED
C19orf55 MISSION shRNA Lentiviral Transduction Particles
chromosome 19 open reading frame 55
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000183157    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144692.1-2271s1c1
Sequence:CCGGGCCAGAAGACTTTGAATTGTACTCGAGTACAATTCAAAGTCTTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179403    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144692.1-3403s1c1
Sequence:CCGGGCTGTCTTTGACTTCTGTCTTCTCGAGAAGACAGAAGTCAAAGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179689    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144692.1-3516s1c1
Sequence:CCGGGCTGTAGTACAATGGCATGATCTCGAGATCATGCCATTGTACTACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180523    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144692.1-839s1c1
Sequence:CCGGGCCAGAGGATGACATTCTGTACTCGAGTACAGAATGTCATCCTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179989    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_144692.1-63s1c1
Sequence:CCGGCAAGATAGTCCCTTTGGAGATCTCGAGATCTCCAAAGGGACTATCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks