EMAIL THIS PAGE TO A FRIEND

C19orf57

chromosome 19 open reading frame 57

22 Gene Product Result for
Species: Human C19orf57(79173)
UniProtKB ID: Q0VDD7, Q13411, Q8N825, Q96D63, Q9BU49
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024323 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024323 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024323 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU082171 MISSION® esiRNA esiRNA human C19orf57 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024323 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024323 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00093755 predicted 339
2 SASI_Hs01_00093756 predicted 763
3 SASI_Hs01_00093757 predicted 551
4 SASI_Hs01_00093758 predicted 481
5 SASI_Hs01_00093760 predicted 1858
6 SASI_Hs02_00356669 predicted 1853
7 SASI_Hs02_00356670 predicted 1384
8 SASI_Hs01_00093762 predicted 1426
9 SASI_Hs01_00093763 predicted 1060
10 SASI_Hs01_00093764 predicted 542
11 SASI_Hs01_00093759 predicted 1968
12 SASI_Hs01_00093761 predicted 215
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024323
C19orf57 MISSION shRNA Bacterial Glycerol Stock
chromosome 19 open reading frame 57
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000172261    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024323.3-684s1c1
Sequence:CCGGCAAGACCACCTGTCAGAACAACTCGAGTTGTTCTGACAGGTGGTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168533    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024323.3-386s1c1
Sequence:CCGGCAGGAAGACAGTGACAAGAAACTCGAGTTTCTTGTCACTGTCTTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168235    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024323.3-1978s1c1
Sequence:CCGGCTTTGAGGTCTGTGTTTCCTTCTCGAGAAGGAAACACAGACCTCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168075    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024323.3-2263s1c1
Sequence:CCGGCCTGTCCGGATTTGCAAATTTCTCGAGAAATTTGCAAATCCGGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024323.3-764s21c1
Sequence:CCGGACACCTACCAAGCATTGATTCCTCGAGGAATCAATGCTTGGTAGGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433425    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024323.3-127s21c1
Sequence:CCGGCAAGGCTAGGAGACTTCTATGCTCGAGCATAGAAGTCTCCTAGCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426927    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024323.3-1854s21c1
Sequence:CCGGGAAGCTTTCAAGCGCCTTAACCTCGAGGTTAAGGCGCTTGAAAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417491    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024323.3-1644s21c1
Sequence:CCGGTTAGCTGTGGAACTCGACTTCCTCGAGGAAGTCGAGTTCCACAGCTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429336    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024323.3-2048s21c1
Sequence:CCGGGTCCTAGTGGACCCTACAAACCTCGAGGTTTGTAGGGTCCACTAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024323
C19orf57 MISSION shRNA shRNA Plasmid DNA
chromosome 19 open reading frame 57
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000172261    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024323.3-684s1c1
Sequence:CCGGCAAGACCACCTGTCAGAACAACTCGAGTTGTTCTGACAGGTGGTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168533    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024323.3-386s1c1
Sequence:CCGGCAGGAAGACAGTGACAAGAAACTCGAGTTTCTTGTCACTGTCTTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168235    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024323.3-1978s1c1
Sequence:CCGGCTTTGAGGTCTGTGTTTCCTTCTCGAGAAGGAAACACAGACCTCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168075    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024323.3-2263s1c1
Sequence:CCGGCCTGTCCGGATTTGCAAATTTCTCGAGAAATTTGCAAATCCGGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024323.3-764s21c1
Sequence:CCGGACACCTACCAAGCATTGATTCCTCGAGGAATCAATGCTTGGTAGGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433425    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024323.3-127s21c1
Sequence:CCGGCAAGGCTAGGAGACTTCTATGCTCGAGCATAGAAGTCTCCTAGCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426927    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024323.3-1854s21c1
Sequence:CCGGGAAGCTTTCAAGCGCCTTAACCTCGAGGTTAAGGCGCTTGAAAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417491    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024323.3-1644s21c1
Sequence:CCGGTTAGCTGTGGAACTCGACTTCCTCGAGGAAGTCGAGTTCCACAGCTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429336    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024323.3-2048s21c1
Sequence:CCGGGTCCTAGTGGACCCTACAAACCTCGAGGTTTGTAGGGTCCACTAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024323
C19orf57 MISSION shRNA Lentiviral Transduction Particles
chromosome 19 open reading frame 57
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000172261    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024323.3-684s1c1
Sequence:CCGGCAAGACCACCTGTCAGAACAACTCGAGTTGTTCTGACAGGTGGTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168533    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024323.3-386s1c1
Sequence:CCGGCAGGAAGACAGTGACAAGAAACTCGAGTTTCTTGTCACTGTCTTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168235    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024323.3-1978s1c1
Sequence:CCGGCTTTGAGGTCTGTGTTTCCTTCTCGAGAAGGAAACACAGACCTCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168075    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024323.3-2263s1c1
Sequence:CCGGCCTGTCCGGATTTGCAAATTTCTCGAGAAATTTGCAAATCCGGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024323.3-764s21c1
Sequence:CCGGACACCTACCAAGCATTGATTCCTCGAGGAATCAATGCTTGGTAGGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433425    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024323.3-127s21c1
Sequence:CCGGCAAGGCTAGGAGACTTCTATGCTCGAGCATAGAAGTCTCCTAGCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426927    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024323.3-1854s21c1
Sequence:CCGGGAAGCTTTCAAGCGCCTTAACCTCGAGGTTAAGGCGCTTGAAAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417491    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024323.3-1644s21c1
Sequence:CCGGTTAGCTGTGGAACTCGACTTCCTCGAGGAAGTCGAGTTCCACAGCTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429336    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024323.3-2048s21c1
Sequence:CCGGGTCCTAGTGGACCCTACAAACCTCGAGGTTTGTAGGGTCCACTAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks