EMAIL THIS PAGE TO A FRIEND

C19orf59

chromosome 19 open reading frame 59

21 Gene Product Result for
Synonyms: MCEMP1
Species: Human C19orf59(199675)
Gene ID:
Human(199675) Summary: This gene encodes a single-pass transmembrane protein. Based on its expression pattern, it is speculated to be involved in regulating mast cell differentiation or immune responses. [provided by RefSeq, Jul 2008]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_174918 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_174918 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_174918 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU014061 MISSION® esiRNA esiRNA targeting human C19orf59 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_174918 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_174918 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00189898 predicted 322
2 SASI_Hs01_00189899 predicted 326
3 SASI_Hs02_00368835 predicted 434
4 SASI_Hs01_00189901 predicted 1049
5 SASI_Hs01_00189903 predicted 1030
6 SASI_Hs02_00368836 predicted 394
7 SASI_Hs01_00189904 predicted 308
8 SASI_Hs01_00189906 predicted 401
9 SASI_Hs02_00368837 predicted 441
10 SASI_Hs02_00368838 predicted 415
11 SASI_Hs01_00189900 predicted 605
12 SASI_Hs01_00189902 predicted 550
13 SASI_Hs01_00189905 predicted 814
14 SASI_Hs01_00189907 predicted 809
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_174918
C19orf59 MISSION shRNA Bacterial Glycerol Stock
chromosome 19 open reading frame 59
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000429368    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_174918.2-643s21c1
Sequence:CCGGTGCCAACGAAGACGGGAAATGCTCGAGCATTTCCCGTCTTCGTTGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174918.2-570s21c1
Sequence:CCGGCACAGTCCTCACCTCAATAAACTCGAGTTTATTGAGGTGAGGACTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414270    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174918.2-472s21c1
Sequence:CCGGGGTCAGGAGCAAGATTGATAGCTCGAGCTATCAATCTTGCTCCTGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174918.1-928s1c1
Sequence:CCGGGACGACATTAGCAGGCATAAACTCGAGTTTATGCCTGCTAATGTCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174918.1-952s1c1
Sequence:CCGGCGTTGACACAAAGGTACAGAACTCGAGTTCTGTACCTTTGTGTCAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174918.1-827s1c1
Sequence:CCGGGTCTCAAACTCCGTACAAGCACTCGAGTGCTTGTACGGAGTTTGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129506    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174918.1-926s1c1
Sequence:CCGGGAGACGACATTAGCAGGCATACTCGAGTATGCCTGCTAATGTCGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130094    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_174918.1-1298s1c1
Sequence:CCGGCCCAGAAAGGTGATGAATGAACTCGAGTTCATTCATCACCTTTCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174918.1-823s1c1
Sequence:CCGGGAATGTCTCAAACTCCGTACACTCGAGTGTACGGAGTTTGAGACATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_174918
C19orf59 MISSION shRNA shRNA Plasmid DNA
chromosome 19 open reading frame 59
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000429368    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_174918.2-643s21c1
Sequence:CCGGTGCCAACGAAGACGGGAAATGCTCGAGCATTTCCCGTCTTCGTTGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174918.2-570s21c1
Sequence:CCGGCACAGTCCTCACCTCAATAAACTCGAGTTTATTGAGGTGAGGACTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414270    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174918.2-472s21c1
Sequence:CCGGGGTCAGGAGCAAGATTGATAGCTCGAGCTATCAATCTTGCTCCTGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174918.1-928s1c1
Sequence:CCGGGACGACATTAGCAGGCATAAACTCGAGTTTATGCCTGCTAATGTCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174918.1-952s1c1
Sequence:CCGGCGTTGACACAAAGGTACAGAACTCGAGTTCTGTACCTTTGTGTCAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174918.1-827s1c1
Sequence:CCGGGTCTCAAACTCCGTACAAGCACTCGAGTGCTTGTACGGAGTTTGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129506    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174918.1-926s1c1
Sequence:CCGGGAGACGACATTAGCAGGCATACTCGAGTATGCCTGCTAATGTCGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130094    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_174918.1-1298s1c1
Sequence:CCGGCCCAGAAAGGTGATGAATGAACTCGAGTTCATTCATCACCTTTCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174918.1-823s1c1
Sequence:CCGGGAATGTCTCAAACTCCGTACACTCGAGTGTACGGAGTTTGAGACATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_174918
C19orf59 MISSION shRNA Lentiviral Transduction Particles
chromosome 19 open reading frame 59
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000429368    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_174918.2-643s21c1
Sequence:CCGGTGCCAACGAAGACGGGAAATGCTCGAGCATTTCCCGTCTTCGTTGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174918.2-570s21c1
Sequence:CCGGCACAGTCCTCACCTCAATAAACTCGAGTTTATTGAGGTGAGGACTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414270    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174918.2-472s21c1
Sequence:CCGGGGTCAGGAGCAAGATTGATAGCTCGAGCTATCAATCTTGCTCCTGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174918.1-928s1c1
Sequence:CCGGGACGACATTAGCAGGCATAAACTCGAGTTTATGCCTGCTAATGTCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174918.1-952s1c1
Sequence:CCGGCGTTGACACAAAGGTACAGAACTCGAGTTCTGTACCTTTGTGTCAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174918.1-827s1c1
Sequence:CCGGGTCTCAAACTCCGTACAAGCACTCGAGTGCTTGTACGGAGTTTGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129506    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174918.1-926s1c1
Sequence:CCGGGAGACGACATTAGCAGGCATACTCGAGTATGCCTGCTAATGTCGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130094    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_174918.1-1298s1c1
Sequence:CCGGCCCAGAAAGGTGATGAATGAACTCGAGTTCATTCATCACCTTTCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174918.1-823s1c1
Sequence:CCGGGAATGTCTCAAACTCCGTACACTCGAGTGTACGGAGTTTGAGACATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks