EMAIL THIS PAGE TO A FRIEND

C19orf60

chromosome 19 open reading frame 60

Species: Human C19orf60(55049)
UniProtKB ID: Q96EN9, E9PAS0, Q8NAX4, Q9NWI0
Gene ID:
41 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA043414 Anti-C19orf60 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001100418 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001100418 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001100418 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001100418 Rosetta Predictions human pricing
NM_001100419 Rosetta Predictions human pricing
NM_017967 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001100418 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00322014 predicted 568
2 SASI_Hs02_00322015 predicted 569
3 SASI_Hs02_00322016 predicted 614
4 SASI_Hs02_00322017 predicted 567
5 SASI_Hs02_00322018 predicted 607
6 SASI_Hs02_00322019 predicted 619
7 SASI_Hs02_00322020 predicted 607
8 SASI_Hs02_00322021 predicted 691
9 SASI_Hs02_00322022 predicted 670
10 SASI_Hs02_00322023 predicted 841
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001100419 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00322024 predicted 503
2 SASI_Hs02_00322025 predicted 500
3 SASI_Hs02_00322026 predicted 551
4 SASI_Hs02_00322027 predicted 495
5 SASI_Hs02_00322028 predicted 543
6 SASI_Hs02_00322029 predicted 555
7 SASI_Hs02_00322030 predicted 544
8 SASI_Hs02_00322031 predicted 626
9 SASI_Hs02_00322032 predicted 606
10 SASI_Hs02_00322033 predicted 774
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017967 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00043280 predicted 1021
2 SASI_Hs01_00043281 predicted 388
3 SASI_Hs01_00043282 predicted 382
4 SASI_Hs01_00043283 predicted 328
5 SASI_Hs01_00043284 predicted 1026
6 SASI_Hs01_00043285 predicted 973
7 SASI_Hs01_00043286 predicted 902
8 SASI_Hs01_00043287 predicted 387
9 SASI_Hs01_00043288 predicted 982
10 SASI_Hs01_00043289 predicted 1136
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001100418
VALIDATED
C19orf60 MISSION shRNA Bacterial Glycerol Stock
chromosome 19 open reading frame 60
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000282843    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_001100418.1-704s21c1
Sequence:CCGGATGCGGAATCTGCCGAGTGATCTCGAGATCACTCGGCAGATTCCGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263874    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001100418.1-693s21c1
Sequence:CCGGCCTTAGGTTTGATGCGGAATCCTCGAGGATTCCGCATCAAACCTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281602    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001100418.1-664s21c1
Sequence:CCGGATGGAGGCGATCAGCGAGGTTCTCGAGAACCTCGCTGATCGCCTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263872    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001100418.1-625s21c1
Sequence:CCGGGTACGGATGCAGCAGCTGAAACTCGAGTTTCAGCTGCTGCATCCGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263873    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_001100418.1-680s21c1
Sequence:CCGGAGGTTCTCCAGGACCTTAGGTCTCGAGACCTAAGGTCCTGGAGAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001100418
VALIDATED
C19orf60 MISSION shRNA shRNA Plasmid DNA
chromosome 19 open reading frame 60
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000282843    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_001100418.1-704s21c1
Sequence:CCGGATGCGGAATCTGCCGAGTGATCTCGAGATCACTCGGCAGATTCCGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263874    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001100418.1-693s21c1
Sequence:CCGGCCTTAGGTTTGATGCGGAATCCTCGAGGATTCCGCATCAAACCTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281602    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001100418.1-664s21c1
Sequence:CCGGATGGAGGCGATCAGCGAGGTTCTCGAGAACCTCGCTGATCGCCTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263872    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001100418.1-625s21c1
Sequence:CCGGGTACGGATGCAGCAGCTGAAACTCGAGTTTCAGCTGCTGCATCCGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263873    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_001100418.1-680s21c1
Sequence:CCGGAGGTTCTCCAGGACCTTAGGTCTCGAGACCTAAGGTCCTGGAGAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001100418
VALIDATED
C19orf60 MISSION shRNA Lentiviral Transduction Particles
chromosome 19 open reading frame 60
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000282843    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_001100418.1-704s21c1
Sequence:CCGGATGCGGAATCTGCCGAGTGATCTCGAGATCACTCGGCAGATTCCGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263874    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001100418.1-693s21c1
Sequence:CCGGCCTTAGGTTTGATGCGGAATCCTCGAGGATTCCGCATCAAACCTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281602    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001100418.1-664s21c1
Sequence:CCGGATGGAGGCGATCAGCGAGGTTCTCGAGAACCTCGCTGATCGCCTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263872    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001100418.1-625s21c1
Sequence:CCGGGTACGGATGCAGCAGCTGAAACTCGAGTTTCAGCTGCTGCATCCGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263873    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_001100418.1-680s21c1
Sequence:CCGGAGGTTCTCCAGGACCTTAGGTCTCGAGACCTAAGGTCCTGGAGAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks