EMAIL THIS PAGE TO A FRIEND

C19orf66

chromosome 19 open reading frame 66

36 Gene Product Result for
Species: Human C19orf66(55337)
UniProtKB ID: Q9NUL5, A8MQT9, Q4G188, Q8IYH6, Q8N8V1
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA042001 Anti-C19orf66 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018381 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018381 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018381 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018381 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018381 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00033782 predicted 1376
2 SASI_Hs01_00033783 predicted 520
3 SASI_Hs01_00033784 predicted 672
4 SASI_Hs01_00033785 predicted 465
5 SASI_Hs01_00033787 predicted 1380
6 SASI_Hs01_00033788 predicted 1507
7 SASI_Hs01_00033789 predicted 453
8 SASI_Hs01_00033790 predicted 1631
9 SASI_Hs01_00033791 predicted 454
10 SASI_Hs02_00351864 predicted 757
11 SASI_Hs01_00033786 predicted 1475
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018381
C19orf66 MISSION shRNA Bacterial Glycerol Stock
chromosome 19 open reading frame 66
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434142    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018381.2-839s21c1
Sequence:CCGGGTGTATCCAACACGGATCCTCCTCGAGGAGGATCCGTGTTGGATACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018381.2-1019s21c1
Sequence:CCGGAGCAACCCTCACATTAGCAGTCTCGAGACTGCTAATGTGAGGGTTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418723    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018381.2-1350s21c1
Sequence:CCGGGAAGTTCTGTGGGACACATTGCTCGAGCAATGTGTCCCACAGAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166541    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018381.1-184s1c1
Sequence:CCGGCTCTGATGAGGAAATTCGGCACTCGAGTGCCGAATTTCCTCATCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165890    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018381.1-360s1c1
Sequence:CCGGGAAGCCAACCTACGCATGTTTCTCGAGAAACATGCGTAGGTTGGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161785    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018381.1-1660s1c1
Sequence:CCGGCCAAAGTACAAGTCACATCTTCTCGAGAAGATGTGACTTGTACTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163151    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018381.1-144s1c1
Sequence:CCGGGAGAAGTTTCATGGGAAGGTACTCGAGTACCTTCCCATGAAACTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164654    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018381.1-146s1c1
Sequence:CCGGGAAGTTTCATGGGAAGGTATCCTCGAGGATACCTTCCCATGAAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161786    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018381.1-260s1c1
Sequence:CCGGCCAAGAACTAAGTAACGATCTCTCGAGAGATCGTTACTTAGTTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160497    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018381.1-1613s1c1
Sequence:CCGGCCAACTTTCTTCAGAGTAATACTCGAGTATTACTCTGAAGAAAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161425    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018381.1-264s1c1
Sequence:CCGGGAACTAAGTAACGATCTGGATCTCGAGATCCAGATCGTTACTTAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018381
C19orf66 MISSION shRNA shRNA Plasmid DNA
chromosome 19 open reading frame 66
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434142    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018381.2-839s21c1
Sequence:CCGGGTGTATCCAACACGGATCCTCCTCGAGGAGGATCCGTGTTGGATACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018381.2-1019s21c1
Sequence:CCGGAGCAACCCTCACATTAGCAGTCTCGAGACTGCTAATGTGAGGGTTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418723    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018381.2-1350s21c1
Sequence:CCGGGAAGTTCTGTGGGACACATTGCTCGAGCAATGTGTCCCACAGAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166541    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018381.1-184s1c1
Sequence:CCGGCTCTGATGAGGAAATTCGGCACTCGAGTGCCGAATTTCCTCATCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165890    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018381.1-360s1c1
Sequence:CCGGGAAGCCAACCTACGCATGTTTCTCGAGAAACATGCGTAGGTTGGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161785    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018381.1-1660s1c1
Sequence:CCGGCCAAAGTACAAGTCACATCTTCTCGAGAAGATGTGACTTGTACTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163151    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018381.1-144s1c1
Sequence:CCGGGAGAAGTTTCATGGGAAGGTACTCGAGTACCTTCCCATGAAACTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164654    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018381.1-146s1c1
Sequence:CCGGGAAGTTTCATGGGAAGGTATCCTCGAGGATACCTTCCCATGAAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161786    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018381.1-260s1c1
Sequence:CCGGCCAAGAACTAAGTAACGATCTCTCGAGAGATCGTTACTTAGTTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160497    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018381.1-1613s1c1
Sequence:CCGGCCAACTTTCTTCAGAGTAATACTCGAGTATTACTCTGAAGAAAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161425    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018381.1-264s1c1
Sequence:CCGGGAACTAAGTAACGATCTGGATCTCGAGATCCAGATCGTTACTTAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018381
C19orf66 MISSION shRNA Lentiviral Transduction Particles
chromosome 19 open reading frame 66
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434142    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018381.2-839s21c1
Sequence:CCGGGTGTATCCAACACGGATCCTCCTCGAGGAGGATCCGTGTTGGATACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018381.2-1019s21c1
Sequence:CCGGAGCAACCCTCACATTAGCAGTCTCGAGACTGCTAATGTGAGGGTTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418723    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018381.2-1350s21c1
Sequence:CCGGGAAGTTCTGTGGGACACATTGCTCGAGCAATGTGTCCCACAGAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166541    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018381.1-184s1c1
Sequence:CCGGCTCTGATGAGGAAATTCGGCACTCGAGTGCCGAATTTCCTCATCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165890    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018381.1-360s1c1
Sequence:CCGGGAAGCCAACCTACGCATGTTTCTCGAGAAACATGCGTAGGTTGGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161785    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018381.1-1660s1c1
Sequence:CCGGCCAAAGTACAAGTCACATCTTCTCGAGAAGATGTGACTTGTACTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163151    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018381.1-144s1c1
Sequence:CCGGGAGAAGTTTCATGGGAAGGTACTCGAGTACCTTCCCATGAAACTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164654    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018381.1-146s1c1
Sequence:CCGGGAAGTTTCATGGGAAGGTATCCTCGAGGATACCTTCCCATGAAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161786    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018381.1-260s1c1
Sequence:CCGGCCAAGAACTAAGTAACGATCTCTCGAGAGATCGTTACTTAGTTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160497    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018381.1-1613s1c1
Sequence:CCGGCCAACTTTCTTCAGAGTAATACTCGAGTATTACTCTGAAGAAAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161425    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018381.1-264s1c1
Sequence:CCGGGAACTAAGTAACGATCTGGATCTCGAGATCCAGATCGTTACTTAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks