EMAIL THIS PAGE TO A FRIEND

C19orf68

chromosome 19 open reading frame 68

44 Gene Product Result for
Species: Human C19orf68(374920)
UniProtKB ID: Q86XI8
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA061028 Anti-C19orf68 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_199341 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_199341 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_199341 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_199341 Rosetta Predictions human pricing
XM_001713770 Rosetta Predictions human pricing
XM_001713771 Rosetta Predictions human pricing
XM_001713772 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199341 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00201717 predicted 1649
2 SASI_Hs01_00201718 predicted 482
3 SASI_Hs01_00201719 predicted 650
4 SASI_Hs01_00201720 predicted 223
5 SASI_Hs01_00201721 predicted 218
6 SASI_Hs01_00201722 predicted 662
7 SASI_Hs01_00201723 predicted 1475
8 SASI_Hs01_00201724 predicted 1472
9 SASI_Hs01_00201725 predicted 250
10 SASI_Hs01_00201726 predicted 1584
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001713770 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00393061 predicted 1644
2 SASI_Hs02_00393062 predicted 1581
3 SASI_Hs02_00393063 predicted 229
4 SASI_Hs02_00393064 predicted 212
5 SASI_Hs02_00393065 predicted 213
6 SASI_Hs02_00393066 predicted 1469
7 SASI_Hs02_00393067 predicted 1462
8 SASI_Hs02_00393068 predicted 244
9 SASI_Hs02_00393069 predicted 1585
10 SASI_Hs02_00393070 predicted 996
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001713771 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00393071 predicted 1649
2 SASI_Hs02_00393072 predicted 1577
3 SASI_Hs02_00393073 predicted 212
4 SASI_Hs02_00393074 predicted 211
5 SASI_Hs02_00393075 predicted 653
6 SASI_Hs02_00393076 predicted 1472
7 SASI_Hs02_00393077 predicted 1467
8 SASI_Hs02_00393078 predicted 249
9 SASI_Hs02_00393079 predicted 1584
10 SASI_Hs02_00393080 predicted 994
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001713772 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00393081 predicted 1644
2 SASI_Hs02_00393082 predicted 1576
3 SASI_Hs02_00393083 predicted 218
4 SASI_Hs02_00393084 predicted 217
5 SASI_Hs02_00393085 predicted 651
6 SASI_Hs02_00393086 predicted 1469
7 SASI_Hs02_00393087 predicted 1469
8 SASI_Hs02_00393088 predicted 246
9 SASI_Hs02_00393089 predicted 1585
10 SASI_Hs02_00393090 predicted 995
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_199341
C19orf68 MISSION shRNA Bacterial Glycerol Stock
chromosome 19 open reading frame 68
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000167956    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199341.1-485s1c1
Sequence:CCGGCAACAAGATCTCCAAGCAGTTCTCGAGAACTGCTTGGAGATCTTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167693    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199341.1-1894s1c1
Sequence:CCGGGAGAAAGTACAGAAGACAGATCTCGAGATCTGTCTTCTGTACTTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199341.1-1471s1c1
Sequence:CCGGCTCCGAAAGAAGGAAGTATTTCTCGAGAAATACTTCCTTCTTTCGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166972    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_199341.1-1973s1c1
Sequence:CCGGGACAAGCAAAGAGACAGAAATCTCGAGATTTCTGTCTCTTTGCTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167119    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_199341.1-1987s1c1
Sequence:CCGGCAGAAATGAAGACATGAGGAACTCGAGTTCCTCATGTCTTCATTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199341.1-331s1c1
Sequence:CCGGCCTTCATCATCGTCAAGCTGACTCGAGTCAGCTTGACGATGATGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199341.1-1790s1c1
Sequence:CCGGGCTAAGAGGATTGGAAGGGTACTCGAGTACCCTTCCAATCCTCTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_199341
C19orf68 MISSION shRNA shRNA Plasmid DNA
chromosome 19 open reading frame 68
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000167956    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199341.1-485s1c1
Sequence:CCGGCAACAAGATCTCCAAGCAGTTCTCGAGAACTGCTTGGAGATCTTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167693    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199341.1-1894s1c1
Sequence:CCGGGAGAAAGTACAGAAGACAGATCTCGAGATCTGTCTTCTGTACTTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199341.1-1471s1c1
Sequence:CCGGCTCCGAAAGAAGGAAGTATTTCTCGAGAAATACTTCCTTCTTTCGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166972    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_199341.1-1973s1c1
Sequence:CCGGGACAAGCAAAGAGACAGAAATCTCGAGATTTCTGTCTCTTTGCTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167119    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_199341.1-1987s1c1
Sequence:CCGGCAGAAATGAAGACATGAGGAACTCGAGTTCCTCATGTCTTCATTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199341.1-331s1c1
Sequence:CCGGCCTTCATCATCGTCAAGCTGACTCGAGTCAGCTTGACGATGATGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199341.1-1790s1c1
Sequence:CCGGGCTAAGAGGATTGGAAGGGTACTCGAGTACCCTTCCAATCCTCTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_199341
C19orf68 MISSION shRNA Lentiviral Transduction Particles
chromosome 19 open reading frame 68
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000167956    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199341.1-485s1c1
Sequence:CCGGCAACAAGATCTCCAAGCAGTTCTCGAGAACTGCTTGGAGATCTTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167693    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199341.1-1894s1c1
Sequence:CCGGGAGAAAGTACAGAAGACAGATCTCGAGATCTGTCTTCTGTACTTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199341.1-1471s1c1
Sequence:CCGGCTCCGAAAGAAGGAAGTATTTCTCGAGAAATACTTCCTTCTTTCGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166972    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_199341.1-1973s1c1
Sequence:CCGGGACAAGCAAAGAGACAGAAATCTCGAGATTTCTGTCTCTTTGCTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167119    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_199341.1-1987s1c1
Sequence:CCGGCAGAAATGAAGACATGAGGAACTCGAGTTCCTCATGTCTTCATTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199341.1-331s1c1
Sequence:CCGGCCTTCATCATCGTCAAGCTGACTCGAGTCAGCTTGACGATGATGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199341.1-1790s1c1
Sequence:CCGGGCTAAGAGGATTGGAAGGGTACTCGAGTACCCTTCCAATCCTCTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks