EMAIL THIS PAGE TO A FRIEND

C19orf69

chromosome 19 open reading frame 69

8 Gene Product Result for
Species: Human C19orf69(100170765)
UniProtKB ID: A6NGS2
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001130514 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001130514 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001130514 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU231541 MISSION® esiRNA esiRNA targeting human C19orf69 human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001130514
C19orf69 MISSION shRNA Bacterial Glycerol Stock
chromosome 19 open reading frame 69
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000377634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001130514.1-142s21c1
Sequence:CCGGACTGGAGGTGCCTGCGATAGTCTCGAGACTATCGCAGGCACCTCCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344465    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001130514.1-749s21c1
Sequence:CCGGACCGGACACACATGGTTATTTCTCGAGAAATAACCATGTGTGTCCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001130514.1-155s21c1
Sequence:CCGGGCGATAGTCTGCTGTGGATCACTCGAGTGATCCACAGCAGACTATCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001130514.1-393s21c1
Sequence:CCGGGATGATGATCTGAGGCTCTGCCTCGAGGCAGAGCCTCAGATCATCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001130514.1-403s21c1
Sequence:CCGGTGAGGCTCTGCCAGTGGATTTCTCGAGAAATCCACTGGCAGAGCCTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344400    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001130514.1-379s21c1
Sequence:CCGGCCACCTGACTTTGAGATGATGCTCGAGCATCATCTCAAAGTCAGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001130514
C19orf69 MISSION shRNA shRNA Plasmid DNA
chromosome 19 open reading frame 69
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000377634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001130514.1-142s21c1
Sequence:CCGGACTGGAGGTGCCTGCGATAGTCTCGAGACTATCGCAGGCACCTCCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344465    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001130514.1-749s21c1
Sequence:CCGGACCGGACACACATGGTTATTTCTCGAGAAATAACCATGTGTGTCCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001130514.1-155s21c1
Sequence:CCGGGCGATAGTCTGCTGTGGATCACTCGAGTGATCCACAGCAGACTATCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000371161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001130514.1-393s21c1
Sequence:CCGGGATGATGATCTGAGGCTCTGCCTCGAGGCAGAGCCTCAGATCATCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001130514.1-403s21c1
Sequence:CCGGTGAGGCTCTGCCAGTGGATTTCTCGAGAAATCCACTGGCAGAGCCTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344400    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001130514.1-379s21c1
Sequence:CCGGCCACCTGACTTTGAGATGATGCTCGAGCATCATCTCAAAGTCAGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001130514
C19orf69 MISSION shRNA Lentiviral Transduction Particles
chromosome 19 open reading frame 69
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000377634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001130514.1-142s21c1
Sequence:CCGGACTGGAGGTGCCTGCGATAGTCTCGAGACTATCGCAGGCACCTCCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344465    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001130514.1-749s21c1
Sequence:CCGGACCGGACACACATGGTTATTTCTCGAGAAATAACCATGTGTGTCCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001130514.1-155s21c1
Sequence:CCGGGCGATAGTCTGCTGTGGATCACTCGAGTGATCCACAGCAGACTATCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001130514.1-393s21c1
Sequence:CCGGGATGATGATCTGAGGCTCTGCCTCGAGGCAGAGCCTCAGATCATCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001130514.1-403s21c1
Sequence:CCGGTGAGGCTCTGCCAGTGGATTTCTCGAGAAATCCACTGGCAGAGCCTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344400    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001130514.1-379s21c1
Sequence:CCGGCCACCTGACTTTGAGATGATGCTCGAGCATCATCTCAAAGTCAGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)