EMAIL THIS PAGE TO A FRIEND

C19orf70

chromosome 19 open reading frame 70

26 Gene Product Result for
Synonyms: P117 QIL1
Species: Human C19orf70(125988)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_205767 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_205767 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_205767 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU120111 MISSION® esiRNA esiRNA human C19orf70 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_205767 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_205767 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00066860 predicted 418
2 SASI_Hs01_00066861 predicted 668
3 SASI_Hs02_00373453 predicted 419
4 SASI_Hs02_00373454 predicted 420
5 SASI_Hs01_00066864 predicted 473
6 SASI_Hs01_00066865 predicted 638
7 SASI_Hs01_00066866 predicted 468
8 SASI_Hs01_00066867 predicted 668
9 SASI_Hs02_00373455 predicted 421
10 SASI_Hs02_00373456 predicted 634
11 SASI_Hs01_00066858 predicted 578
12 SASI_Hs01_00066859 predicted 586
13 SASI_Hs01_00066862 predicted 577
14 SASI_Hs01_00066863 predicted 662
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_205767
VALIDATED
C19orf70 MISSION shRNA Bacterial Glycerol Stock
chromosome 19 open reading frame 70
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000231825    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_205767.1-477s21c1
Sequence:CCGGCGTCTACCTGGTGTACGACCACTCGAGTGGTCGTACACCAGGTAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_205767.1-575s21c1
Sequence:CCGGAGTTCAGCCAGTACGTGTGTCCTCGAGGACACACGTACTGGCTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_205767.1-662s21c1
Sequence:CCGGCCTGGAATGCAGGCATCATGACTCGAGTCATGATGCCTGCATTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_205767.1-443s21c1
Sequence:CCGGGGTTCCTCATCAAGGGAAGTGCTCGAGCACTTCCCTTGATGAGGAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231827    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_205767.1-630s21c1
Sequence:CCGGCCCTCCAAAGATTTACTTTCCCTCGAGGGAAAGTAAATCTTTGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_205767
VALIDATED
C19orf70 MISSION shRNA shRNA Plasmid DNA
chromosome 19 open reading frame 70
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000231825    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_205767.1-477s21c1
Sequence:CCGGCGTCTACCTGGTGTACGACCACTCGAGTGGTCGTACACCAGGTAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_205767.1-575s21c1
Sequence:CCGGAGTTCAGCCAGTACGTGTGTCCTCGAGGACACACGTACTGGCTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_205767.1-662s21c1
Sequence:CCGGCCTGGAATGCAGGCATCATGACTCGAGTCATGATGCCTGCATTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_205767.1-443s21c1
Sequence:CCGGGGTTCCTCATCAAGGGAAGTGCTCGAGCACTTCCCTTGATGAGGAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231827    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_205767.1-630s21c1
Sequence:CCGGCCCTCCAAAGATTTACTTTCCCTCGAGGGAAAGTAAATCTTTGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_205767
VALIDATED
C19orf70 MISSION shRNA Lentiviral Transduction Particles
chromosome 19 open reading frame 70
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000231825    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_205767.1-477s21c1
Sequence:CCGGCGTCTACCTGGTGTACGACCACTCGAGTGGTCGTACACCAGGTAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_205767.1-575s21c1
Sequence:CCGGAGTTCAGCCAGTACGTGTGTCCTCGAGGACACACGTACTGGCTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_205767.1-662s21c1
Sequence:CCGGCCTGGAATGCAGGCATCATGACTCGAGTCATGATGCCTGCATTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_205767.1-443s21c1
Sequence:CCGGGGTTCCTCATCAAGGGAAGTGCTCGAGCACTTCCCTTGATGAGGAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231827    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_205767.1-630s21c1
Sequence:CCGGCCCTCCAAAGATTTACTTTCCCTCGAGGGAAAGTAAATCTTTGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks