EMAIL THIS PAGE TO A FRIEND

C19orf71

chromosome 19 open reading frame 71

35 Gene Product Result for
Species: Human C19orf71(100128569)
UniProtKB ID: A6NCJ1
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA048654 Anti-C19ORF71 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001135580 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001135580 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001135580 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU120851 MISSION® esiRNA esiRNA human C19orf71 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001722762 Rosetta Predictions human pricing
XM_001726154 Rosetta Predictions human pricing
XM_001726177 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001722762 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00451154 predicted 1393
2 SASI_Hs02_00451155 predicted 1816
3 SASI_Hs02_00451156 predicted 1801
4 SASI_Hs02_00451157 predicted 2361
5 SASI_Hs02_00451158 predicted 1963
6 SASI_Hs02_00451159 predicted 1591
7 SASI_Hs02_00451160 predicted 2358
8 SASI_Hs02_00451161 predicted 1760
9 SASI_Hs02_00451162 predicted 1766
10 SASI_Hs02_00451163 predicted 1805
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001726154 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00472320 predicted 1398
2 SASI_Hs02_00472321 predicted 1813
3 SASI_Hs02_00472322 predicted 1800
4 SASI_Hs02_00472323 predicted 2366
5 SASI_Hs02_00472324 predicted 1962
6 SASI_Hs02_00472325 predicted 1591
7 SASI_Hs02_00472326 predicted 2357
8 SASI_Hs02_00472327 predicted 1766
9 SASI_Hs02_00472328 predicted 1768
10 SASI_Hs02_00472329 predicted 1802
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001726177 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00472510 predicted 1405
2 SASI_Hs02_00472511 predicted 1823
3 SASI_Hs02_00472512 predicted 1819
4 SASI_Hs02_00472513 predicted 2376
5 SASI_Hs02_00472514 predicted 1970
6 SASI_Hs02_00472515 predicted 1601
7 SASI_Hs02_00472516 predicted 2371
8 SASI_Hs02_00472517 predicted 1773
9 SASI_Hs02_00472518 predicted 1777
10 SASI_Hs02_00472519 predicted 1812
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001135580
C19orf71 MISSION shRNA Bacterial Glycerol Stock
chromosome 19 open reading frame 71
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000284125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001135580.1-458s21c1
Sequence:CCGGGCAAGGAATACGTGCTCAACACTCGAGTGTTGAGCACGTATTCCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001135580.1-93s21c1
Sequence:CCGGACCGCTGTACAGCGATGACTACTCGAGTAGTCATCGCTGTACAGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269893    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001135580.1-433s21c1
Sequence:CCGGCTGTGGAAAGACAGGCCAATCCTCGAGGATTGGCCTGTCTTTCCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001135580.1-300s21c1
Sequence:CCGGCTGGCACAGCTGCTACCAACACTCGAGTGTTGGTAGCAGCTGTGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001135580.1-501s21c1
Sequence:CCGGACTGTGGAGGGCATCAGACTACTCGAGTAGTCTGATGCCCTCCACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001135580
C19orf71 MISSION shRNA shRNA Plasmid DNA
chromosome 19 open reading frame 71
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000284125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001135580.1-458s21c1
Sequence:CCGGGCAAGGAATACGTGCTCAACACTCGAGTGTTGAGCACGTATTCCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001135580.1-93s21c1
Sequence:CCGGACCGCTGTACAGCGATGACTACTCGAGTAGTCATCGCTGTACAGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269893    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001135580.1-433s21c1
Sequence:CCGGCTGTGGAAAGACAGGCCAATCCTCGAGGATTGGCCTGTCTTTCCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001135580.1-300s21c1
Sequence:CCGGCTGGCACAGCTGCTACCAACACTCGAGTGTTGGTAGCAGCTGTGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001135580.1-501s21c1
Sequence:CCGGACTGTGGAGGGCATCAGACTACTCGAGTAGTCTGATGCCCTCCACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001135580
C19orf71 MISSION shRNA Lentiviral Transduction Particles
chromosome 19 open reading frame 71
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000284125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001135580.1-458s21c1
Sequence:CCGGGCAAGGAATACGTGCTCAACACTCGAGTGTTGAGCACGTATTCCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001135580.1-93s21c1
Sequence:CCGGACCGCTGTACAGCGATGACTACTCGAGTAGTCATCGCTGTACAGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269893    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001135580.1-433s21c1
Sequence:CCGGCTGTGGAAAGACAGGCCAATCCTCGAGGATTGGCCTGTCTTTCCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001135580.1-300s21c1
Sequence:CCGGCTGGCACAGCTGCTACCAACACTCGAGTGTTGGTAGCAGCTGTGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001135580.1-501s21c1
Sequence:CCGGACTGTGGAGGGCATCAGACTACTCGAGTAGTCTGATGCCCTCCACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks