EMAIL THIS PAGE TO A FRIEND

C19orf73

chromosome 19 open reading frame 73

37 Gene Product Result for
Species: Human C19orf73(55150)
UniProtKB ID: Q9NVV2, Q6NSX4
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018111 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018111 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018111 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018111 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018111 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00187356 predicted 403
2 SASI_Hs01_00187357 predicted 260
3 SASI_Hs01_00187358 predicted 361
4 SASI_Hs02_00351306 predicted 422
5 SASI_Hs01_00187360 predicted 491
6 SASI_Hs01_00187361 predicted 515
7 SASI_Hs01_00187362 predicted 511
8 SASI_Hs01_00187363 predicted 367
9 SASI_Hs01_00187364 predicted 487
10 SASI_Hs01_00187365 predicted 486
11 SASI_Hs01_00187359 predicted 201
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018111
C19orf73 MISSION shRNA Bacterial Glycerol Stock
chromosome 19 open reading frame 73
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000377493    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018111.2-541s21c1
Sequence:CCGGACCTAGGGAGAGGTCTTAACCCTCGAGGGTTAAGACCTCTCCCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370089    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018111.2-432s21c1
Sequence:CCGGGCAGCGTTGTCCTCAGTTCTGCTCGAGCAGAACTGAGGACAACGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370041    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018111.2-413s21c1
Sequence:CCGGCAGACGCTCTTAAGGGTAGGCCTCGAGGCCTACCCTTAAGAGCGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370046    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018111.2-552s21c1
Sequence:CCGGGGTCTTAACCTCTGTTCTCAGCTCGAGCTGAGAACAGAGGTTAAGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370042    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018111.2-156s21c1
Sequence:CCGGTCCGGAAAGACGCGCTGTGTTCTCGAGAACACAGCGCGTCTTTCCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263710    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018111.2-172s21c1
Sequence:CCGGGTGTTTGGAAGGTGGAGTGAGCTCGAGCTCACTCCACCTTCCAAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018111.2-268s21c1
Sequence:CCGGGACTCCCACGCAGACAGTAGTCTCGAGACTACTGTCTGCGTGGGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263708    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018111.2-405s21c1
Sequence:CCGGTTCGCCCTCAGACGCTCTTAACTCGAGTTAAGAGCGTCTGAGGGCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018111
C19orf73 MISSION shRNA shRNA Plasmid DNA
chromosome 19 open reading frame 73
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000377493    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018111.2-541s21c1
Sequence:CCGGACCTAGGGAGAGGTCTTAACCCTCGAGGGTTAAGACCTCTCCCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370089    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018111.2-432s21c1
Sequence:CCGGGCAGCGTTGTCCTCAGTTCTGCTCGAGCAGAACTGAGGACAACGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370041    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018111.2-413s21c1
Sequence:CCGGCAGACGCTCTTAAGGGTAGGCCTCGAGGCCTACCCTTAAGAGCGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370046    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018111.2-552s21c1
Sequence:CCGGGGTCTTAACCTCTGTTCTCAGCTCGAGCTGAGAACAGAGGTTAAGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370042    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018111.2-156s21c1
Sequence:CCGGTCCGGAAAGACGCGCTGTGTTCTCGAGAACACAGCGCGTCTTTCCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263710    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018111.2-172s21c1
Sequence:CCGGGTGTTTGGAAGGTGGAGTGAGCTCGAGCTCACTCCACCTTCCAAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018111.2-268s21c1
Sequence:CCGGGACTCCCACGCAGACAGTAGTCTCGAGACTACTGTCTGCGTGGGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263708    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018111.2-405s21c1
Sequence:CCGGTTCGCCCTCAGACGCTCTTAACTCGAGTTAAGAGCGTCTGAGGGCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018111
C19orf73 MISSION shRNA Lentiviral Transduction Particles
chromosome 19 open reading frame 73
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000377493    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018111.2-541s21c1
Sequence:CCGGACCTAGGGAGAGGTCTTAACCCTCGAGGGTTAAGACCTCTCCCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370089    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018111.2-432s21c1
Sequence:CCGGGCAGCGTTGTCCTCAGTTCTGCTCGAGCAGAACTGAGGACAACGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370041    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018111.2-413s21c1
Sequence:CCGGCAGACGCTCTTAAGGGTAGGCCTCGAGGCCTACCCTTAAGAGCGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370046    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018111.2-552s21c1
Sequence:CCGGGGTCTTAACCTCTGTTCTCAGCTCGAGCTGAGAACAGAGGTTAAGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370042    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018111.2-156s21c1
Sequence:CCGGTCCGGAAAGACGCGCTGTGTTCTCGAGAACACAGCGCGTCTTTCCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263710    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018111.2-172s21c1
Sequence:CCGGGTGTTTGGAAGGTGGAGTGAGCTCGAGCTCACTCCACCTTCCAAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018111.2-268s21c1
Sequence:CCGGGACTCCCACGCAGACAGTAGTCTCGAGACTACTGTCTGCGTGGGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263708    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018111.2-405s21c1
Sequence:CCGGTTCGCCCTCAGACGCTCTTAACTCGAGTTAAGAGCGTCTGAGGGCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks