EMAIL THIS PAGE TO A FRIEND

C19orf77

chromosome 19 open reading frame 77

44 Gene Product Result for
Species: Human C19orf77(284422)
UniProtKB ID: O75264, B9EJF4, Q9P059
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001136503 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001136503 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001136503 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU094971 MISSION® esiRNA esiRNA human AC005551.1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001726225 Rosetta Predictions human pricing
XM_209196 Rosetta Predictions human pricing
XM_939969 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001726225 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00472809 predicted 671
2 SASI_Hs02_00472810 predicted 672
3 SASI_Hs02_00472811 predicted 679
4 SASI_Hs02_00472812 predicted 681
5 SASI_Hs02_00472813 predicted 86
6 SASI_Hs02_00472814 predicted 847
7 SASI_Hs02_00472815 predicted 530
8 SASI_Hs02_00472816 predicted 549
9 SASI_Hs02_00472817 predicted 83
10 SASI_Hs02_00472818 predicted 849
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_209196 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00478950 predicted 679
2 SASI_Hs02_00478951 predicted 679
3 SASI_Hs02_00478952 predicted 674
4 SASI_Hs02_00478953 predicted 679
5 SASI_Hs01_00296145 predicted 85
6 SASI_Hs01_00296146 predicted 841
7 SASI_Hs01_00296147 predicted 535
8 SASI_Hs01_00296148 predicted 549
9 SASI_Hs01_00296149 predicted 87
10 SASI_Hs01_00296150 predicted 849
11 SASI_Hs01_00296144 predicted 563
12 SASI_Hs01_00296151 predicted 859
13 SASI_Hs01_00296152 predicted 548
14 SASI_Hs01_00296153 predicted 532
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_939969 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00483980 predicted 675
2 SASI_Hs02_00483981 predicted 680
3 SASI_Hs02_00483982 predicted 675
4 SASI_Hs02_00483983 predicted 682
5 SASI_Hs02_00483984 predicted 86
6 SASI_Hs02_00483985 predicted 843
7 SASI_Hs02_00483986 predicted 534
8 SASI_Hs02_00483987 predicted 552
9 SASI_Hs02_00483988 predicted 88
10 SASI_Hs02_00483989 predicted 849
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001136503
C19orf77 MISSION shRNA Bacterial Glycerol Stock
chromosome 19 open reading frame 77
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000262823    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136503.1-200s21c1
Sequence:CCGGTTCCTGTTCATCGTCTATTTGCTCGAGCAAATAGACGATGAACAGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262824    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001136503.1-541s21c1
Sequence:CCGGTGGACTTGAAGCCCGTGAAATCTCGAGATTTCACGGGCTTCAAGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262821    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136503.1-390s21c1
Sequence:CCGGAGGAAGGAGAGAGCAACTTGGCTCGAGCCAAGTTGCTCTCTCCTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136503.1-458s21c1
Sequence:CCGGAGCACAGTCATGTGAAGATTCCTCGAGGAATCTTCACATGACTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262820    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136503.1-287s21c1
Sequence:CCGGAGAATGGAGTCCAACCTATACCTCGAGGTATAGGTTGGACTCCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001136503
C19orf77 MISSION shRNA shRNA Plasmid DNA
chromosome 19 open reading frame 77
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000262823    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136503.1-200s21c1
Sequence:CCGGTTCCTGTTCATCGTCTATTTGCTCGAGCAAATAGACGATGAACAGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262824    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001136503.1-541s21c1
Sequence:CCGGTGGACTTGAAGCCCGTGAAATCTCGAGATTTCACGGGCTTCAAGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262821    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136503.1-390s21c1
Sequence:CCGGAGGAAGGAGAGAGCAACTTGGCTCGAGCCAAGTTGCTCTCTCCTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136503.1-458s21c1
Sequence:CCGGAGCACAGTCATGTGAAGATTCCTCGAGGAATCTTCACATGACTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262820    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136503.1-287s21c1
Sequence:CCGGAGAATGGAGTCCAACCTATACCTCGAGGTATAGGTTGGACTCCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001136503
C19orf77 MISSION shRNA Lentiviral Transduction Particles
chromosome 19 open reading frame 77
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000262823    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136503.1-200s21c1
Sequence:CCGGTTCCTGTTCATCGTCTATTTGCTCGAGCAAATAGACGATGAACAGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262824    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001136503.1-541s21c1
Sequence:CCGGTGGACTTGAAGCCCGTGAAATCTCGAGATTTCACGGGCTTCAAGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262821    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136503.1-390s21c1
Sequence:CCGGAGGAAGGAGAGAGCAACTTGGCTCGAGCCAAGTTGCTCTCTCCTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136503.1-458s21c1
Sequence:CCGGAGCACAGTCATGTGAAGATTCCTCGAGGAATCTTCACATGACTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262820    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136503.1-287s21c1
Sequence:CCGGAGAATGGAGTCCAACCTATACCTCGAGGTATAGGTTGGACTCCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks