EMAIL THIS PAGE TO A FRIEND

C19orf80

chromosome 19 open reading frame 80

22 Gene Product Result for
Synonyms: ANGPTL8 PRO1185 PVPA599 RIFL TD26
Species: Human C19orf80(55908)
UniProtKB ID: Q6UXH0, Q9NQZ1
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB3501080 Anti-BETATROPHIN antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunohistochemistry, western blot pricing
SAB1409514 Anti-C19orf80 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018687 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018687 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018687 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU049641 MISSION® esiRNA esiRNA human DOCK6 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018687 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018687 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00035946 predicted 596
2 SASI_Hs01_00035947 predicted 362
3 SASI_Hs02_00352200 predicted 605
4 SASI_Hs02_00352201 predicted 779
5 SASI_Hs02_00352202 predicted 751
6 SASI_Hs01_00035951 predicted 362
7 SASI_Hs02_00352203 predicted 303
8 SASI_Hs01_00035953 predicted 639
9 SASI_Hs02_00352204 predicted 419
10 SASI_Hs01_00035954 predicted 619
11 SASI_Hs01_00035948 predicted 561
12 SASI_Hs01_00035949 predicted 544
13 SASI_Hs01_00035950 predicted 350
14 SASI_Hs01_00035952 predicted 797
15 SASI_Hs01_00035955 predicted 649
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018687
C19orf80 MISSION shRNA Bacterial Glycerol Stock
chromosome 19 open reading frame 80
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000419031    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018687.5-78s21c1
Sequence:CCGGATGTACTGCACTCGCACAGCACTCGAGTGCTGTGCGAGTGCAGTACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416417    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018687.5-456s21c1
Sequence:CCGGCAGATGGAGGAGGATATTCTGCTCGAGCAGAATATCCTCCTCCATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166350    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018687.3-804s1c1
Sequence:CCGGCCTACCGAGAATTTGAGGTCTCTCGAGAGACCTCAAATTCTCGGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161452    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018687.3-808s1c1
Sequence:CCGGCCGAGAATTTGAGGTCTTAAACTCGAGTTTAAGACCTCAAATTCTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162915    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018687.3-349s1c1
Sequence:CCGGGTTATACCTTAGACCCTCAGTCTCGAGACTGAGGGTCTAAGGTATAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163687    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018687.3-334s1c1
Sequence:CCGGGCTGAAGTTGAGGCTGTTATACTCGAGTATAACAGCCTCAACTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164962    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018687.3-667s1c1
Sequence:CCGGGATGGAGGAGGATATTCTGCACTCGAGTGCAGAATATCCTCCTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165699    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018687.3-823s1c1
Sequence:CCGGCTTAAAGGCTCACGCTGACAACTCGAGTTGTCAGCGTGAGCCTTTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165847    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018687.3-346s1c1
Sequence:CCGGGCTGTTATACCTTAGACCCTCCTCGAGGAGGGTCTAAGGTATAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166009    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018687.3-661s1c1
Sequence:CCGGGACTCAGATGGAGGAGGATATCTCGAGATATCCTCCTCCATCTGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018687
C19orf80 MISSION shRNA shRNA Plasmid DNA
chromosome 19 open reading frame 80
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000419031    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018687.5-78s21c1
Sequence:CCGGATGTACTGCACTCGCACAGCACTCGAGTGCTGTGCGAGTGCAGTACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416417    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018687.5-456s21c1
Sequence:CCGGCAGATGGAGGAGGATATTCTGCTCGAGCAGAATATCCTCCTCCATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166350    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018687.3-804s1c1
Sequence:CCGGCCTACCGAGAATTTGAGGTCTCTCGAGAGACCTCAAATTCTCGGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161452    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018687.3-808s1c1
Sequence:CCGGCCGAGAATTTGAGGTCTTAAACTCGAGTTTAAGACCTCAAATTCTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162915    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018687.3-349s1c1
Sequence:CCGGGTTATACCTTAGACCCTCAGTCTCGAGACTGAGGGTCTAAGGTATAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163687    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018687.3-334s1c1
Sequence:CCGGGCTGAAGTTGAGGCTGTTATACTCGAGTATAACAGCCTCAACTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164962    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018687.3-667s1c1
Sequence:CCGGGATGGAGGAGGATATTCTGCACTCGAGTGCAGAATATCCTCCTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165699    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018687.3-823s1c1
Sequence:CCGGCTTAAAGGCTCACGCTGACAACTCGAGTTGTCAGCGTGAGCCTTTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165847    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018687.3-346s1c1
Sequence:CCGGGCTGTTATACCTTAGACCCTCCTCGAGGAGGGTCTAAGGTATAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166009    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018687.3-661s1c1
Sequence:CCGGGACTCAGATGGAGGAGGATATCTCGAGATATCCTCCTCCATCTGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018687
C19orf80 MISSION shRNA Lentiviral Transduction Particles
chromosome 19 open reading frame 80
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000419031    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018687.5-78s21c1
Sequence:CCGGATGTACTGCACTCGCACAGCACTCGAGTGCTGTGCGAGTGCAGTACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416417    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018687.5-456s21c1
Sequence:CCGGCAGATGGAGGAGGATATTCTGCTCGAGCAGAATATCCTCCTCCATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166350    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018687.3-804s1c1
Sequence:CCGGCCTACCGAGAATTTGAGGTCTCTCGAGAGACCTCAAATTCTCGGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161452    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018687.3-808s1c1
Sequence:CCGGCCGAGAATTTGAGGTCTTAAACTCGAGTTTAAGACCTCAAATTCTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162915    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018687.3-349s1c1
Sequence:CCGGGTTATACCTTAGACCCTCAGTCTCGAGACTGAGGGTCTAAGGTATAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163687    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018687.3-334s1c1
Sequence:CCGGGCTGAAGTTGAGGCTGTTATACTCGAGTATAACAGCCTCAACTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164962    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018687.3-667s1c1
Sequence:CCGGGATGGAGGAGGATATTCTGCACTCGAGTGCAGAATATCCTCCTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165699    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018687.3-823s1c1
Sequence:CCGGCTTAAAGGCTCACGCTGACAACTCGAGTTGTCAGCGTGAGCCTTTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165847    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018687.3-346s1c1
Sequence:CCGGGCTGTTATACCTTAGACCCTCCTCGAGGAGGGTCTAAGGTATAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166009    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018687.3-661s1c1
Sequence:CCGGGACTCAGATGGAGGAGGATATCTCGAGATATCCTCCTCCATCTGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks