EMAIL THIS PAGE TO A FRIEND

C1D

C1D nuclear receptor corepressor

131 Gene Product Result for
Synonyms: LRP1 SUN-CoR SUNCOR hC1D
UniProtKB ID: Q13901, A8K336, D6W5F8, Q05D64
Gene ID:
Human(10438) Summary: The protein encoded by this gene is a DNA binding and apoptosis-inducing protein and is localized in the nucleus. It is also a Rac3-interacting protein which acts as a corepressor for the thyroid hormone receptor. This protein is thought to regulate TRAX/Translin complex formation. Alternate splicing results in multiple transcript variants that encode the same protein. Multiple pseudogenes of this gene are found on chromosome 10.[provided by RefSeq, Jun 2010]
Mouse(57316) C1D nuclear receptor co-repressor
Rat(289810) C1D nuclear receptor co-repressor
Zebrafish(474329) C1D nuclear receptor co-repressor
cow(506667) C1D nuclear receptor corepressor
domestic cat(101089432) C1D nuclear receptor corepressor
dog(612549) C1D nuclear receptor corepressor
chicken(421267) C1D nuclear receptor corepressor
sheep(101111532) C1D nuclear receptor corepressor
naked mole-rat(101707831) C1D nuclear receptor corepressor
domestic guinea pig(100731007) C1D nuclear receptor corepressor
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020558 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_020558 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_020558 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006333 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006333 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006333 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006333 Rosetta Predictions human pricing
NM_173177 Rosetta Predictions human pricing
NM_001106021 Rosetta Predictions rat pricing
NM_020558 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006333 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00341367 predicted 265
2 SASI_Hs01_00241826 predicted 934
3 SASI_Hs02_00341368 predicted 278
4 SASI_Hs01_00241821 predicted 908
5 SASI_Hs02_00341369 predicted 285
6 SASI_Hs02_00341370 predicted 288
7 SASI_Hs01_00241822 predicted 271
8 SASI_Hs01_00241823 predicted 278
9 SASI_Hs01_00241824 predicted 274
10 SASI_Hs01_00241825 predicted 279
11 SASI_Hs01_00241827 predicted 275
12 SASI_Hs01_00241828 predicted 909
13 SASI_Hs01_00241829 predicted 914
14 SASI_Hs01_00241830 predicted 581
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173177 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00368143 predicted 250
2 SASI_Hs01_00128603 predicted 928
3 SASI_Hs02_00368144 predicted 264
4 SASI_Hs01_00128598 predicted 901
5 SASI_Hs02_00368145 predicted 280
6 SASI_Hs02_00368146 predicted 273
7 SASI_Hs01_00128599 predicted 262
8 SASI_Hs01_00128600 predicted 256
9 SASI_Hs01_00128601 predicted 265
10 SASI_Hs01_00128602 predicted 259
11 SASI_Hs01_00128604 predicted 262
12 SASI_Hs01_00128605 predicted 896
13 SASI_Hs01_00128606 predicted 900
14 SASI_Hs01_00128607 predicted 576
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106021 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00214842 predicted 384
2 SASI_Rn02_00214843 predicted 275
3 SASI_Rn02_00214844 predicted 744
4 SASI_Rn02_00214845 predicted 124
5 SASI_Rn02_00214846 predicted 131
6 SASI_Rn02_00214847 predicted 301
7 SASI_Rn02_00214848 predicted 222
8 SASI_Rn02_00214849 predicted 239
9 SASI_Rn02_00214850 predicted 369
10 SASI_Rn02_00214851 predicted 271
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020558 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00063902 predicted 336
2 SASI_Mm01_00063903 predicted 322
3 SASI_Mm01_00063904 predicted 214
4 SASI_Mm01_00063906 predicted 328
5 SASI_Mm01_00063907 predicted 309
6 SASI_Mm01_00063908 predicted 227
7 SASI_Mm01_00063909 predicted 519
8 SASI_Mm01_00063910 predicted 180
9 SASI_Mm01_00063911 predicted 63
10 SASI_Mm02_00325586 predicted 267
11 SASI_Mm01_00063905 predicted 214
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020558
VALIDATED
C1D MISSION shRNA Bacterial Glycerol Stock
C1D nuclear receptor corepressor
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000103690    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020558.2-915s1c1
Sequence:CCGGGCTGTCTTGATATTCAAAGTACTCGAGTACTTTGAATATCAAGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020558.2-223s1c1
Sequence:CCGGGTTTCTGCATACACCTTAAATCTCGAGATTTAAGGTGTATGCAGAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020558.2-82s1c1
Sequence:CCGGCCCGTAGAAATTCACGAGTCTCTCGAGAGACTCGTGAATTTCTACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103692    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020558.2-322s1c1
Sequence:CCGGAGAGTCTACATGAACAGAGTTCTCGAGAACTCTGTTCATGTAGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294749    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020558.3-146s21c1
Sequence:CCGGGAAGACCATGATGGCTGTTTCCTCGAGGAAACAGCCATCATGGTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294686    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020558.3-261s21c1
Sequence:CCGGTTGGCAACTCAAGGAGTTAATCTCGAGATTAACTCCTTGAGTTGCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287308    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020558.3-914s21c1
Sequence:CCGGGCTGTCTTGATATTCAAAGTACTCGAGTACTTTGAATATCAAGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294750    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020558.3-291s21c1
Sequence:CCGGCATCCAGTGAAGCAGGAACTGCTCGAGCAGTTCCTGCTTCACTGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306931    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020558.3-180s21c1
Sequence:CCGGTTGCAGAAGTTGGACCCATTGCTCGAGCAATGGGTCCAACTTCTGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020558
VALIDATED
C1D MISSION shRNA shRNA Plasmid DNA
C1D nuclear receptor corepressor
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000103690    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020558.2-915s1c1
Sequence:CCGGGCTGTCTTGATATTCAAAGTACTCGAGTACTTTGAATATCAAGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020558.2-223s1c1
Sequence:CCGGGTTTCTGCATACACCTTAAATCTCGAGATTTAAGGTGTATGCAGAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020558.2-82s1c1
Sequence:CCGGCCCGTAGAAATTCACGAGTCTCTCGAGAGACTCGTGAATTTCTACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103692    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020558.2-322s1c1
Sequence:CCGGAGAGTCTACATGAACAGAGTTCTCGAGAACTCTGTTCATGTAGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294749    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020558.3-146s21c1
Sequence:CCGGGAAGACCATGATGGCTGTTTCCTCGAGGAAACAGCCATCATGGTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294686    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020558.3-261s21c1
Sequence:CCGGTTGGCAACTCAAGGAGTTAATCTCGAGATTAACTCCTTGAGTTGCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287308    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020558.3-914s21c1
Sequence:CCGGGCTGTCTTGATATTCAAAGTACTCGAGTACTTTGAATATCAAGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294750    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020558.3-291s21c1
Sequence:CCGGCATCCAGTGAAGCAGGAACTGCTCGAGCAGTTCCTGCTTCACTGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306931    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020558.3-180s21c1
Sequence:CCGGTTGCAGAAGTTGGACCCATTGCTCGAGCAATGGGTCCAACTTCTGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020558
VALIDATED
C1D MISSION shRNA Lentiviral Transduction Particles
C1D nuclear receptor corepressor
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000103690    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020558.2-915s1c1
Sequence:CCGGGCTGTCTTGATATTCAAAGTACTCGAGTACTTTGAATATCAAGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020558.2-223s1c1
Sequence:CCGGGTTTCTGCATACACCTTAAATCTCGAGATTTAAGGTGTATGCAGAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020558.2-82s1c1
Sequence:CCGGCCCGTAGAAATTCACGAGTCTCTCGAGAGACTCGTGAATTTCTACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103692    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020558.2-322s1c1
Sequence:CCGGAGAGTCTACATGAACAGAGTTCTCGAGAACTCTGTTCATGTAGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294749    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020558.3-146s21c1
Sequence:CCGGGAAGACCATGATGGCTGTTTCCTCGAGGAAACAGCCATCATGGTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294686    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020558.3-261s21c1
Sequence:CCGGTTGGCAACTCAAGGAGTTAATCTCGAGATTAACTCCTTGAGTTGCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287308    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020558.3-914s21c1
Sequence:CCGGGCTGTCTTGATATTCAAAGTACTCGAGTACTTTGAATATCAAGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294750    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020558.3-291s21c1
Sequence:CCGGCATCCAGTGAAGCAGGAACTGCTCGAGCAGTTCCTGCTTCACTGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306931    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020558.3-180s21c1
Sequence:CCGGTTGCAGAAGTTGGACCCATTGCTCGAGCAATGGGTCCAACTTCTGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006333
VALIDATED
C1D MISSION shRNA Bacterial Glycerol Stock
C1D nuclear receptor corepressor
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000154048    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006333.2-278s1c1
Sequence:CCGGCAACCCAAGGAGTTAATCCTACTCGAGTAGGATTAACTCCTTGGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150675    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006333.2-625s1c1
Sequence:CCGGGCTAAATACTTTCCTCTCCAACTCGAGTTGGAGAGGAAAGTATTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006333.2-111s1c1
Sequence:CCGGGTATTTGTCAGCGTTTGAGAACTCGAGTTCTCAAACGCTGACAAATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151268    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006333.2-164s1c1
Sequence:CCGGCCATGATGTCTGTTTCTAGAACTCGAGTTCTAGAAACAGACATCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006333.2-283s1c1
Sequence:CCGGCAAGGAGTTAATCCTAAGGAACTCGAGTTCCTTAGGATTAACTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153490    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006333.2-196s1c1
Sequence:CCGGCAGAAGTTGGATCCACTTGAACTCGAGTTCAAGTGGATCCAACTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153565    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006333.2-187s1c1
Sequence:CCGGGAGTTGTTGCAGAAGTTGGATCTCGAGATCCAACTTCTGCAACAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153781    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006333.2-108s1c1
Sequence:CCGGCGAGTATTTGTCAGCGTTTGACTCGAGTCAAACGCTGACAAATACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000377381    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006333.3-747s21c1
Sequence:CCGGCTCTTGATGAGACTCTTATTTCTCGAGAAATAAGAGTCTCATCAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370069    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006333.3-880s21c1
Sequence:CCGGATGCTATCTGTAGGCTGAAATCTCGAGATTTCAGCCTACAGATAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343505    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006333.3-137s21c1
Sequence:CCGGCGAGTATTTGTCAGCGTTTGACTCGAGTCAAACGCTGACAAATACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006333.3-193s21c1
Sequence:CCGGCCATGATGTCTGTTTCTAGAACTCGAGTTCTAGAAACAGACATCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000352938    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006333.3-927s21c1
Sequence:CCGGGATATTAAGAAAGCGTGAAATCTCGAGATTTCACGCTTTCTTAATATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006333
VALIDATED
C1D MISSION shRNA shRNA Plasmid DNA
C1D nuclear receptor corepressor
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000154048    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006333.2-278s1c1
Sequence:CCGGCAACCCAAGGAGTTAATCCTACTCGAGTAGGATTAACTCCTTGGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150675    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006333.2-625s1c1
Sequence:CCGGGCTAAATACTTTCCTCTCCAACTCGAGTTGGAGAGGAAAGTATTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006333.2-111s1c1
Sequence:CCGGGTATTTGTCAGCGTTTGAGAACTCGAGTTCTCAAACGCTGACAAATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151268    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006333.2-164s1c1
Sequence:CCGGCCATGATGTCTGTTTCTAGAACTCGAGTTCTAGAAACAGACATCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006333.2-283s1c1
Sequence:CCGGCAAGGAGTTAATCCTAAGGAACTCGAGTTCCTTAGGATTAACTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153490    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006333.2-196s1c1
Sequence:CCGGCAGAAGTTGGATCCACTTGAACTCGAGTTCAAGTGGATCCAACTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153565    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006333.2-187s1c1
Sequence:CCGGGAGTTGTTGCAGAAGTTGGATCTCGAGATCCAACTTCTGCAACAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153781    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006333.2-108s1c1
Sequence:CCGGCGAGTATTTGTCAGCGTTTGACTCGAGTCAAACGCTGACAAATACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000377381    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006333.3-747s21c1
Sequence:CCGGCTCTTGATGAGACTCTTATTTCTCGAGAAATAAGAGTCTCATCAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370069    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006333.3-880s21c1
Sequence:CCGGATGCTATCTGTAGGCTGAAATCTCGAGATTTCAGCCTACAGATAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343505    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006333.3-137s21c1
Sequence:CCGGCGAGTATTTGTCAGCGTTTGACTCGAGTCAAACGCTGACAAATACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006333.3-193s21c1
Sequence:CCGGCCATGATGTCTGTTTCTAGAACTCGAGTTCTAGAAACAGACATCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000352938    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006333.3-927s21c1
Sequence:CCGGGATATTAAGAAAGCGTGAAATCTCGAGATTTCACGCTTTCTTAATATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006333
VALIDATED
C1D MISSION shRNA Lentiviral Transduction Particles
C1D nuclear receptor corepressor
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000154048    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006333.2-278s1c1
Sequence:CCGGCAACCCAAGGAGTTAATCCTACTCGAGTAGGATTAACTCCTTGGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150675    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006333.2-625s1c1
Sequence:CCGGGCTAAATACTTTCCTCTCCAACTCGAGTTGGAGAGGAAAGTATTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006333.2-111s1c1
Sequence:CCGGGTATTTGTCAGCGTTTGAGAACTCGAGTTCTCAAACGCTGACAAATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151268    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006333.2-164s1c1
Sequence:CCGGCCATGATGTCTGTTTCTAGAACTCGAGTTCTAGAAACAGACATCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006333.2-283s1c1
Sequence:CCGGCAAGGAGTTAATCCTAAGGAACTCGAGTTCCTTAGGATTAACTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153490    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006333.2-196s1c1
Sequence:CCGGCAGAAGTTGGATCCACTTGAACTCGAGTTCAAGTGGATCCAACTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153565    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006333.2-187s1c1
Sequence:CCGGGAGTTGTTGCAGAAGTTGGATCTCGAGATCCAACTTCTGCAACAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153781    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006333.2-108s1c1
Sequence:CCGGCGAGTATTTGTCAGCGTTTGACTCGAGTCAAACGCTGACAAATACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000377381    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006333.3-747s21c1
Sequence:CCGGCTCTTGATGAGACTCTTATTTCTCGAGAAATAAGAGTCTCATCAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370069    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006333.3-880s21c1
Sequence:CCGGATGCTATCTGTAGGCTGAAATCTCGAGATTTCAGCCTACAGATAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343505    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006333.3-137s21c1
Sequence:CCGGCGAGTATTTGTCAGCGTTTGACTCGAGTCAAACGCTGACAAATACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006333.3-193s21c1
Sequence:CCGGCCATGATGTCTGTTTCTAGAACTCGAGTTCTAGAAACAGACATCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000352938    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006333.3-927s21c1
Sequence:CCGGGATATTAAGAAAGCGTGAAATCTCGAGATTTCACGCTTTCTTAATATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks