EMAIL THIS PAGE TO A FRIEND

C1GALT1

core 1 synthase, glycoprotein-N-acetylgalactosamine 3-beta-galactosyltransferase, 1

Synonyms: C1GALT T-synthase
UniProtKB ID: Q9NS00, Q96QH4, Q9BTU1
Gene ID:
Human(56913) Summary: The protein encoded by this gene generates the common core 1 O-glycan structure, Gal-beta-1-3GalNAc-R, by the transfer of Gal from UDP-Gal to GalNAc-alpha-1-R. Core 1 is a precursor for many extended mucin-type O-glycans on cell surface and secreted glycoproteins. Studies in mice suggest that this gene plays a key role in thrombopoiesis and kidney homeostasis.[provided by RefSeq, Sep 2010]
Mouse(94192) core 1 synthase, glycoprotein-N-acetylgalactosamine 3-beta-galactosyltransferase, 1
Rat(65044) core 1 synthase, glycoprotein-N-acetylgalactosamine 3-beta-galactosyltransferase, 1
chicken(420575) core 1 synthase, glycoprotein-N-acetylgalactosamine 3-beta-galactosyltransferase, 1
cow(539417) core 1 synthase, glycoprotein-N-acetylgalactosamine 3-beta-galactosyltransferase, 1
domestic cat(101096459) core 1 synthase, glycoprotein-N-acetylgalactosamine 3-beta-galactosyltransferase, 1
dog(482314) core 1 synthase, glycoprotein-N-acetylgalactosamine 3-beta-galactosyltransferase, 1
domestic guinea pig(100714236) core 1 synthase, glycoprotein-N-acetylgalactosamine 3-beta-galactosyltransferase, 1
naked mole-rat(101704643) core 1 synthase, glycoprotein-N-acetylgalactosamine 3-beta-galactosyltransferase, 1
sheep(101120567) core 1 synthase, glycoprotein-N-acetylgalactosamine 3-beta-galactosyltransferase, 1
111 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_052993 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_052993 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_052993 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_020156 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020156 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020156 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020156 Rosetta Predictions human pricing
NM_022950 Rosetta Predictions rat pricing
NM_052993 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020156 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00212551 predicted 1183
2 SASI_Hs02_00353052 predicted 467
3 SASI_Hs01_00212552 predicted 847
4 SASI_Hs01_00212553 predicted 1053
5 SASI_Hs02_00353053 predicted 674
6 SASI_Hs02_00353054 predicted 490
7 SASI_Hs01_00212554 predicted 911
8 SASI_Hs01_00212555 predicted 804
9 SASI_Hs01_00212556 predicted 1165
10 SASI_Hs01_00212558 predicted 410
11 SASI_Hs01_00212557 predicted 595
12 SASI_Hs01_00212559 predicted 664
13 SASI_Hs01_00212560 predicted 237
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022950 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00077415 predicted 1115
2 SASI_Rn01_00077416 predicted 1118
3 SASI_Rn01_00077417 predicted 215
4 SASI_Rn01_00077418 predicted 610
5 SASI_Rn01_00077419 predicted 395
6 SASI_Rn01_00077420 predicted 746
7 SASI_Rn01_00077421 predicted 262
8 SASI_Rn01_00077422 predicted 239
9 SASI_Rn01_00077423 predicted 1013
10 SASI_Rn02_00263683 predicted 342
11 SASI_Rn01_00077424 predicted 739
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_052993 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00146191 predicted 974
2 SASI_Mm01_00146192 predicted 532
3 SASI_Mm01_00146193 predicted 416
4 SASI_Mm02_00337510 predicted 813
5 SASI_Mm01_00146195 predicted 939
6 SASI_Mm01_00146196 predicted 428
7 SASI_Mm01_00146197 predicted 1002
8 SASI_Mm01_00146198 predicted 671
9 SASI_Mm01_00146199 predicted 1014
10 SASI_Mm01_00146200 predicted 890
11 SASI_Mm01_00146194 predicted 863
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_052993
VALIDATED
C1GALT1 MISSION shRNA Bacterial Glycerol Stock
core 1 synthase, glycoprotein-N-acetylgalactosamine 3-beta-galactosyltransferase, 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000332669    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052993.2-641s21c1
Sequence:CCGGCCTGAACAACCCATTTACTTTCTCGAGAAAGTAAATGGGTTGTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332670    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052993.2-1097s21c1
Sequence:CCGGCCTGAGAATATACTGAAAGAACTCGAGTTCTTTCAGTATATTCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332671    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052993.2-415s21c1
Sequence:CCGGCCAGCGTTGTAATAAAGTGTTCTCGAGAACACTTTATTACAACGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332596    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052993.2-978s21c1
Sequence:CCGGGCTGTTCTGATATTGCAGTTTCTCGAGAAACTGCAATATCAGAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332594    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052993.2-1336s21c1
Sequence:CCGGCGTGTCTTGATACAGTAATATCTCGAGATATTACTGTATCAAGACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110365    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052993.2-1336s1c1
Sequence:CCGGCGTGTCTTGATACAGTAATATCTCGAGATATTACTGTATCAAGACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110366    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_052993.2-1097s1c1
Sequence:CCGGCCTGAGAATATACTGAAAGAACTCGAGTTCTTTCAGTATATTCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110368    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_052993.2-978s1c1
Sequence:CCGGGCTGTTCTGATATTGCAGTTTCTCGAGAAACTGCAATATCAGAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052993.2-641s1c1
Sequence:CCGGCCTGAACAACCCATTTACTTTCTCGAGAAAGTAAATGGGTTGTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110367    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_052993.2-415s1c1
Sequence:CCGGCCAGCGTTGTAATAAAGTGTTCTCGAGAACACTTTATTACAACGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_052993
VALIDATED
C1GALT1 MISSION shRNA shRNA Plasmid DNA
core 1 synthase, glycoprotein-N-acetylgalactosamine 3-beta-galactosyltransferase, 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000332669    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052993.2-641s21c1
Sequence:CCGGCCTGAACAACCCATTTACTTTCTCGAGAAAGTAAATGGGTTGTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332670    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052993.2-1097s21c1
Sequence:CCGGCCTGAGAATATACTGAAAGAACTCGAGTTCTTTCAGTATATTCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332671    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052993.2-415s21c1
Sequence:CCGGCCAGCGTTGTAATAAAGTGTTCTCGAGAACACTTTATTACAACGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332596    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052993.2-978s21c1
Sequence:CCGGGCTGTTCTGATATTGCAGTTTCTCGAGAAACTGCAATATCAGAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332594    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052993.2-1336s21c1
Sequence:CCGGCGTGTCTTGATACAGTAATATCTCGAGATATTACTGTATCAAGACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110365    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052993.2-1336s1c1
Sequence:CCGGCGTGTCTTGATACAGTAATATCTCGAGATATTACTGTATCAAGACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110366    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_052993.2-1097s1c1
Sequence:CCGGCCTGAGAATATACTGAAAGAACTCGAGTTCTTTCAGTATATTCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110368    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_052993.2-978s1c1
Sequence:CCGGGCTGTTCTGATATTGCAGTTTCTCGAGAAACTGCAATATCAGAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052993.2-641s1c1
Sequence:CCGGCCTGAACAACCCATTTACTTTCTCGAGAAAGTAAATGGGTTGTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110367    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_052993.2-415s1c1
Sequence:CCGGCCAGCGTTGTAATAAAGTGTTCTCGAGAACACTTTATTACAACGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_052993
VALIDATED
C1GALT1 MISSION shRNA Lentiviral Transduction Particles
core 1 synthase, glycoprotein-N-acetylgalactosamine 3-beta-galactosyltransferase, 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000332669    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052993.2-641s21c1
Sequence:CCGGCCTGAACAACCCATTTACTTTCTCGAGAAAGTAAATGGGTTGTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332670    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052993.2-1097s21c1
Sequence:CCGGCCTGAGAATATACTGAAAGAACTCGAGTTCTTTCAGTATATTCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332671    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052993.2-415s21c1
Sequence:CCGGCCAGCGTTGTAATAAAGTGTTCTCGAGAACACTTTATTACAACGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332596    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052993.2-978s21c1
Sequence:CCGGGCTGTTCTGATATTGCAGTTTCTCGAGAAACTGCAATATCAGAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332594    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052993.2-1336s21c1
Sequence:CCGGCGTGTCTTGATACAGTAATATCTCGAGATATTACTGTATCAAGACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110365    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052993.2-1336s1c1
Sequence:CCGGCGTGTCTTGATACAGTAATATCTCGAGATATTACTGTATCAAGACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110366    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_052993.2-1097s1c1
Sequence:CCGGCCTGAGAATATACTGAAAGAACTCGAGTTCTTTCAGTATATTCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110368    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_052993.2-978s1c1
Sequence:CCGGGCTGTTCTGATATTGCAGTTTCTCGAGAAACTGCAATATCAGAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052993.2-641s1c1
Sequence:CCGGCCTGAACAACCCATTTACTTTCTCGAGAAAGTAAATGGGTTGTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110367    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_052993.2-415s1c1
Sequence:CCGGCCAGCGTTGTAATAAAGTGTTCTCGAGAACACTTTATTACAACGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020156
VALIDATED
C1GALT1 MISSION shRNA Bacterial Glycerol Stock
core 1 synthase, glycoprotein-N-acetylgalactosamine 3-beta-galactosyltransferase, 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000289384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_020156.2-333s21c1
Sequence:CCGGCCCAGCCTAATGTTCTTCATACTCGAGTATGAAGAACATTAGGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289383    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_020156.2-820s21c1
Sequence:CCGGGCCTTATGTAAAGCAGGGCTACTCGAGTAGCCCTGCTTTACATAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289382    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020156.2-1125s21c1
Sequence:CCGGGCTCTGATCTTGCAGTTTCTTCTCGAGAAGAAACTGCAAGATCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289447    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_020156.2-1232s21c1
Sequence:CCGGCCTACCTTACCTGAACGTATACTCGAGTATACGTTCAGGTAAGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306827    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_020156.2-562s21c1
Sequence:CCGGGCGTTGTAACAAAGTGTTGTTCTCGAGAACAACACTTTGTTACAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020156.1-964s1c1
Sequence:CCGGGCTCTGATCTTGCAGTTTCTTCTCGAGAAGAAACTGCAAGATCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020156.1-1071s1c1
Sequence:CCGGCCTACCTTACCTGAACGTATACTCGAGTATACGTTCAGGTAAGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035410    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_020156.1-659s1c1
Sequence:CCGGGCCTTATGTAAAGCAGGGCTACTCGAGTAGCCCTGCTTTACATAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020156.1-172s1c1
Sequence:CCGGCCCAGCCTAATGTTCTTCATACTCGAGTATGAAGAACATTAGGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020156.1-401s1c1
Sequence:CCGGGCGTTGTAACAAAGTGTTGTTCTCGAGAACAACACTTTGTTACAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020156
VALIDATED
C1GALT1 MISSION shRNA shRNA Plasmid DNA
core 1 synthase, glycoprotein-N-acetylgalactosamine 3-beta-galactosyltransferase, 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000289384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_020156.2-333s21c1
Sequence:CCGGCCCAGCCTAATGTTCTTCATACTCGAGTATGAAGAACATTAGGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289383    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_020156.2-820s21c1
Sequence:CCGGGCCTTATGTAAAGCAGGGCTACTCGAGTAGCCCTGCTTTACATAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289382    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020156.2-1125s21c1
Sequence:CCGGGCTCTGATCTTGCAGTTTCTTCTCGAGAAGAAACTGCAAGATCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289447    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_020156.2-1232s21c1
Sequence:CCGGCCTACCTTACCTGAACGTATACTCGAGTATACGTTCAGGTAAGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306827    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_020156.2-562s21c1
Sequence:CCGGGCGTTGTAACAAAGTGTTGTTCTCGAGAACAACACTTTGTTACAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020156.1-964s1c1
Sequence:CCGGGCTCTGATCTTGCAGTTTCTTCTCGAGAAGAAACTGCAAGATCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020156.1-1071s1c1
Sequence:CCGGCCTACCTTACCTGAACGTATACTCGAGTATACGTTCAGGTAAGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035410    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_020156.1-659s1c1
Sequence:CCGGGCCTTATGTAAAGCAGGGCTACTCGAGTAGCCCTGCTTTACATAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020156.1-172s1c1
Sequence:CCGGCCCAGCCTAATGTTCTTCATACTCGAGTATGAAGAACATTAGGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020156.1-401s1c1
Sequence:CCGGGCGTTGTAACAAAGTGTTGTTCTCGAGAACAACACTTTGTTACAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020156
VALIDATED
C1GALT1 MISSION shRNA Lentiviral Transduction Particles
core 1 synthase, glycoprotein-N-acetylgalactosamine 3-beta-galactosyltransferase, 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000289384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_020156.2-333s21c1
Sequence:CCGGCCCAGCCTAATGTTCTTCATACTCGAGTATGAAGAACATTAGGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289383    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_020156.2-820s21c1
Sequence:CCGGGCCTTATGTAAAGCAGGGCTACTCGAGTAGCCCTGCTTTACATAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289382    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020156.2-1125s21c1
Sequence:CCGGGCTCTGATCTTGCAGTTTCTTCTCGAGAAGAAACTGCAAGATCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289447    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_020156.2-1232s21c1
Sequence:CCGGCCTACCTTACCTGAACGTATACTCGAGTATACGTTCAGGTAAGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306827    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_020156.2-562s21c1
Sequence:CCGGGCGTTGTAACAAAGTGTTGTTCTCGAGAACAACACTTTGTTACAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020156.1-964s1c1
Sequence:CCGGGCTCTGATCTTGCAGTTTCTTCTCGAGAAGAAACTGCAAGATCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020156.1-1071s1c1
Sequence:CCGGCCTACCTTACCTGAACGTATACTCGAGTATACGTTCAGGTAAGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035410    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_020156.1-659s1c1
Sequence:CCGGGCCTTATGTAAAGCAGGGCTACTCGAGTAGCCCTGCTTTACATAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020156.1-172s1c1
Sequence:CCGGCCCAGCCTAATGTTCTTCATACTCGAGTATGAAGAACATTAGGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020156.1-401s1c1
Sequence:CCGGGCGTTGTAACAAAGTGTTGTTCTCGAGAACAACACTTTGTTACAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks