EMAIL THIS PAGE TO A FRIEND

C1GALT1C1

C1GALT1-specific chaperone 1

64 Gene Product Result for
Synonyms: C1GALT2 C38H2-L1 COSMC MST143 TNPS
UniProtKB ID: Q96EU7, A8K246, Q8WWS3, Q9NZX1
Gene ID:
Human(29071) Summary: This gene encodes a type II transmembrane protein that is similar to the core 1 beta1,3-galactosyltransferase 1, which catalyzes the synthesis of the core-1 structure, also known as Thomsen-Friedenreich antigen, on O-linked glycans. This gene product lacks the galactosyltransferase activity itself, but instead acts as a molecular chaperone required for the folding, stability and full activity of the core 1 beta1,3-galactosyltransferase 1. Mutations in this gene have been associated with Tn syndrome. Alternatively spliced transcript variants encoding the same protein have been identified. [provided by RefSeq, Dec 2009]
Mouse(59048) C1GALT1-specific chaperone 1
Rat(302499) C1GALT1-specific chaperone 1
Zebrafish(324052) C1GALT1-specific chaperone 1
chicken(422362) C1GALT1-specific chaperone 1
domestic cat(101088470) C1GALT1-specific chaperone 1
cow(531644) C1GALT1-specific chaperone 1
dog(100685864) C1GALT1-specific chaperone 1
naked mole-rat(101713150) C1GALT1-specific chaperone 1
domestic guinea pig(100714926) C1GALT1-specific chaperone 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152692 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152692 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152692 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_021550 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021550 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021550 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU150761 MISSION® esiRNA esiRNA human C1GALT1C1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001011551 Rosetta Predictions human pricing
NM_152692 Rosetta Predictions human pricing
NM_001030033 Rosetta Predictions rat pricing
NM_021550 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001011551 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00131071 predicted 1199
2 SASI_Hs01_00131073 predicted 977
3 SASI_Hs01_00131075 predicted 513
4 SASI_Hs01_00131076 predicted 1197
5 SASI_Hs01_00131077 predicted 732
6 SASI_Hs01_00131078 predicted 514
7 SASI_Hs01_00131079 predicted 851
8 SASI_Hs01_00131080 predicted 514
9 SASI_Hs02_00305992 predicted 1150
10 SASI_Hs02_00305993 predicted 493
11 SASI_Hs01_00131072 predicted 975
12 SASI_Hs01_00131074 predicted 440
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152692 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00190856 predicted 1379
2 SASI_Hs01_00190858 predicted 1152
3 SASI_Hs01_00190860 predicted 681
4 SASI_Hs01_00190861 predicted 1364
5 SASI_Hs01_00190862 predicted 901
6 SASI_Hs01_00190863 predicted 692
7 SASI_Hs01_00190864 predicted 1021
8 SASI_Hs01_00190865 predicted 690
9 SASI_Hs02_00366581 predicted 1324
10 SASI_Hs02_00366582 predicted 667
11 SASI_Hs01_00190857 predicted 1139
12 SASI_Hs01_00190859 predicted 613
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001030033 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00084825 predicted 299
2 SASI_Rn01_00084826 predicted 944
3 SASI_Rn01_00084827 predicted 361
4 SASI_Rn01_00084828 predicted 417
5 SASI_Rn01_00084829 predicted 205
6 SASI_Rn01_00084831 predicted 666
7 SASI_Rn01_00084832 predicted 540
8 SASI_Rn01_00084833 predicted 467
9 SASI_Rn01_00084834 predicted 780
10 SASI_Rn02_00203539 predicted 878
11 SASI_Rn01_00084830 predicted 254
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021550 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00101457 predicted 273
2 SASI_Mm02_00326312 predicted 970
3 SASI_Mm02_00326313 predicted 387
4 SASI_Mm01_00101459 predicted 333
5 SASI_Mm02_00326314 predicted 1083
6 SASI_Mm01_00101460 predicted 435
7 SASI_Mm02_00326315 predicted 1075
8 SASI_Mm01_00101461 predicted 691
9 SASI_Mm01_00101462 predicted 1097
10 SASI_Mm01_00101463 predicted 562
11 SASI_Mm01_00101456 predicted 688
12 SASI_Mm01_00101458 predicted 328
13 SASI_Mm01_00101464 predicted 317
14 SASI_Mm01_00101465 predicted 453
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152692
VALIDATED
C1GALT1C1 MISSION shRNA Bacterial Glycerol Stock
C1GALT1-specific chaperone 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000034989    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_152692.2-933s1c1
Sequence:CCGGGCCTGAAATATGCTGGAGTATCTCGAGATACTCCAGCATATTTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152692.2-689s1c1
Sequence:CCGGCCCACTACGTTTGCTATCATTCTCGAGAATGATAGCAAACGTAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034992    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_152692.2-453s1c1
Sequence:CCGGGCTTTCGAGTATACTGTATTACTCGAGTAATACAGTATACTCGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152692.2-629s1c1
Sequence:CCGGGCTTACAAATACGCCTTTGATCTCGAGATCAAAGGCGTATTTGTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152692.2-1141s1c1
Sequence:CCGGCCTTAGGGCATTTGGGCATATCTCGAGATATGCCCAAATGCCCTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152692.3-544s21c1
Sequence:CCGGGCTTTCGAGTATACTGTATTACTCGAGTAATACAGTATACTCGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299779    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152692.3-1232s21c1
Sequence:CCGGCCTTAGGGCATTTGGGCATATCTCGAGATATGCCCAAATGCCCTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152692.3-720s21c1
Sequence:CCGGGCTTACAAATACGCCTTTGATCTCGAGATCAAAGGCGTATTTGTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299776    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152692.3-1024s21c1
Sequence:CCGGGCCTGAAATATGCTGGAGTATCTCGAGATACTCCAGCATATTTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299855    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152692.3-780s21c1
Sequence:CCGGCCCACTACGTTTGCTATCATTCTCGAGAATGATAGCAAACGTAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152692
VALIDATED
C1GALT1C1 MISSION shRNA shRNA Plasmid DNA
C1GALT1-specific chaperone 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000034989    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_152692.2-933s1c1
Sequence:CCGGGCCTGAAATATGCTGGAGTATCTCGAGATACTCCAGCATATTTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152692.2-689s1c1
Sequence:CCGGCCCACTACGTTTGCTATCATTCTCGAGAATGATAGCAAACGTAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034992    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_152692.2-453s1c1
Sequence:CCGGGCTTTCGAGTATACTGTATTACTCGAGTAATACAGTATACTCGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152692.2-629s1c1
Sequence:CCGGGCTTACAAATACGCCTTTGATCTCGAGATCAAAGGCGTATTTGTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152692.2-1141s1c1
Sequence:CCGGCCTTAGGGCATTTGGGCATATCTCGAGATATGCCCAAATGCCCTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152692.3-544s21c1
Sequence:CCGGGCTTTCGAGTATACTGTATTACTCGAGTAATACAGTATACTCGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299779    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152692.3-1232s21c1
Sequence:CCGGCCTTAGGGCATTTGGGCATATCTCGAGATATGCCCAAATGCCCTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152692.3-720s21c1
Sequence:CCGGGCTTACAAATACGCCTTTGATCTCGAGATCAAAGGCGTATTTGTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299776    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152692.3-1024s21c1
Sequence:CCGGGCCTGAAATATGCTGGAGTATCTCGAGATACTCCAGCATATTTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299855    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152692.3-780s21c1
Sequence:CCGGCCCACTACGTTTGCTATCATTCTCGAGAATGATAGCAAACGTAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152692
VALIDATED
C1GALT1C1 MISSION shRNA Lentiviral Transduction Particles
C1GALT1-specific chaperone 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000034989    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_152692.2-933s1c1
Sequence:CCGGGCCTGAAATATGCTGGAGTATCTCGAGATACTCCAGCATATTTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152692.2-689s1c1
Sequence:CCGGCCCACTACGTTTGCTATCATTCTCGAGAATGATAGCAAACGTAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034992    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_152692.2-453s1c1
Sequence:CCGGGCTTTCGAGTATACTGTATTACTCGAGTAATACAGTATACTCGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152692.2-629s1c1
Sequence:CCGGGCTTACAAATACGCCTTTGATCTCGAGATCAAAGGCGTATTTGTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152692.2-1141s1c1
Sequence:CCGGCCTTAGGGCATTTGGGCATATCTCGAGATATGCCCAAATGCCCTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152692.3-544s21c1
Sequence:CCGGGCTTTCGAGTATACTGTATTACTCGAGTAATACAGTATACTCGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299779    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152692.3-1232s21c1
Sequence:CCGGCCTTAGGGCATTTGGGCATATCTCGAGATATGCCCAAATGCCCTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152692.3-720s21c1
Sequence:CCGGGCTTACAAATACGCCTTTGATCTCGAGATCAAAGGCGTATTTGTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299776    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152692.3-1024s21c1
Sequence:CCGGGCCTGAAATATGCTGGAGTATCTCGAGATACTCCAGCATATTTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299855    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152692.3-780s21c1
Sequence:CCGGCCCACTACGTTTGCTATCATTCTCGAGAATGATAGCAAACGTAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021550
VALIDATED
C1GALT1C1 MISSION shRNA Bacterial Glycerol Stock
C1GALT1-specific chaperone 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000093800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021550.2-810s1c1
Sequence:CCGGCCTGAAATACGCCGGAGTATTCTCGAGAATACTCCGGCGTATTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021550.2-944s1c1
Sequence:CCGGGCTCTGATATGGCTGTTACTTCTCGAGAAGTAACAGCCATATCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021550.2-1018s1c1
Sequence:CCGGCTTAGGGCATTTGGACATGTTCTCGAGAACATGTCCAAATGCCCTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093801    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021550.2-321s1c1
Sequence:CCGGCAGTAAGAGTTTCCGGGTATACTCGAGTATACCCGGAAACTCTTACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093799    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021550.2-1238s1c1
Sequence:CCGGCCCTTATATCATTCCTGAGAACTCGAGTTCTCAGGAATGATATAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000351603    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021550.2-1238s21c3
Sequence:CCGGCCCTTATATCATTCCTGAGAACTCGAGTTCTCAGGAATGATATAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311333    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021550.2-633s21c1
Sequence:CCGGCTATCTCGGACACACTGTAAACTCGAGTTTACAGTGTGTCCGAGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305505    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021550.2-494s21c1
Sequence:CCGGTGATGAGGAAAGCTTACAAATCTCGAGATTTGTAAGCTTTCCTCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305506    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021550.2-203s21c1
Sequence:CCGGTCACTATGCTAGGCCACATTACTCGAGTAATGTGGCCTAGCATAGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000351433    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021550.2-321s21c2
Sequence:CCGGCAGTAAGAGTTTCCGGGTATACTCGAGTATACCCGGAAACTCTTACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021550
VALIDATED
C1GALT1C1 MISSION shRNA shRNA Plasmid DNA
C1GALT1-specific chaperone 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000093800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021550.2-810s1c1
Sequence:CCGGCCTGAAATACGCCGGAGTATTCTCGAGAATACTCCGGCGTATTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021550.2-944s1c1
Sequence:CCGGGCTCTGATATGGCTGTTACTTCTCGAGAAGTAACAGCCATATCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021550.2-1018s1c1
Sequence:CCGGCTTAGGGCATTTGGACATGTTCTCGAGAACATGTCCAAATGCCCTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093801    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021550.2-321s1c1
Sequence:CCGGCAGTAAGAGTTTCCGGGTATACTCGAGTATACCCGGAAACTCTTACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093799    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021550.2-1238s1c1
Sequence:CCGGCCCTTATATCATTCCTGAGAACTCGAGTTCTCAGGAATGATATAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000351603    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021550.2-1238s21c3
Sequence:CCGGCCCTTATATCATTCCTGAGAACTCGAGTTCTCAGGAATGATATAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311333    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021550.2-633s21c1
Sequence:CCGGCTATCTCGGACACACTGTAAACTCGAGTTTACAGTGTGTCCGAGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305505    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021550.2-494s21c1
Sequence:CCGGTGATGAGGAAAGCTTACAAATCTCGAGATTTGTAAGCTTTCCTCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305506    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021550.2-203s21c1
Sequence:CCGGTCACTATGCTAGGCCACATTACTCGAGTAATGTGGCCTAGCATAGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000351433    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021550.2-321s21c2
Sequence:CCGGCAGTAAGAGTTTCCGGGTATACTCGAGTATACCCGGAAACTCTTACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021550
VALIDATED
C1GALT1C1 MISSION shRNA Lentiviral Transduction Particles
C1GALT1-specific chaperone 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000093800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021550.2-810s1c1
Sequence:CCGGCCTGAAATACGCCGGAGTATTCTCGAGAATACTCCGGCGTATTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021550.2-944s1c1
Sequence:CCGGGCTCTGATATGGCTGTTACTTCTCGAGAAGTAACAGCCATATCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021550.2-1018s1c1
Sequence:CCGGCTTAGGGCATTTGGACATGTTCTCGAGAACATGTCCAAATGCCCTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093801    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021550.2-321s1c1
Sequence:CCGGCAGTAAGAGTTTCCGGGTATACTCGAGTATACCCGGAAACTCTTACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093799    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021550.2-1238s1c1
Sequence:CCGGCCCTTATATCATTCCTGAGAACTCGAGTTCTCAGGAATGATATAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000351603    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021550.2-1238s21c3
Sequence:CCGGCCCTTATATCATTCCTGAGAACTCGAGTTCTCAGGAATGATATAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311333    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021550.2-633s21c1
Sequence:CCGGCTATCTCGGACACACTGTAAACTCGAGTTTACAGTGTGTCCGAGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305505    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021550.2-494s21c1
Sequence:CCGGTGATGAGGAAAGCTTACAAATCTCGAGATTTGTAAGCTTTCCTCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305506    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021550.2-203s21c1
Sequence:CCGGTCACTATGCTAGGCCACATTACTCGAGTAATGTGGCCTAGCATAGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000351433    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021550.2-321s21c2
Sequence:CCGGCAGTAAGAGTTTCCGGGTATACTCGAGTATACCCGGAAACTCTTACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks