EMAIL THIS PAGE TO A FRIEND

C1QA

complement component 1, q subcomponent, A chain

56 Gene Product Result for
UniProtKB ID: P02745, B2R4X2, Q5T963
Gene ID:
Human(712) Summary: This gene encodes a major constituent of the human complement subcomponent C1q. C1q associates with C1r and C1s in order to yield the first component of the serum complement system. Deficiency of C1q has been associated with lupus erythematosus and glomerulonephritis. C1q is composed of 18 polypeptide chains: six A-chains, six B-chains, and six C-chains. Each chain contains a collagen-like region located near the N terminus and a C-terminal globular region. The A-, B-, and C-chains are arranged in the order A-C-B on chromosome 1. This gene encodes the A-chain polypeptide of human complement subcomponent C1q. [provided by RefSeq, Jul 2008]
Mouse(12259) complement component 1, q subcomponent, alpha polypeptide
Rat(298566) complement component 1, q subcomponent, A chain
Zebrafish(553548) complement component 1, q subcomponent, A chain
chicken(419504) complement component 1, q subcomponent, A chain
dog(478194) complement component 1, q subcomponent, A chain
domestic cat(101096082) complement component 1, q subcomponent, A chain
cow(534961) complement component 1, q subcomponent, A chain
domestic guinea pig(100724576) complement component 1, q subcomponent, A chain
naked mole-rat(101703487) complement component 1, q subcomponent, A chain
sheep(101102126) complement component 1, q subcomponent, A chain
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007572 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007572 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007572 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015991 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015991 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015991 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015991 Rosetta Predictions human pricing
NM_001008515 Rosetta Predictions rat pricing
NM_007572 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015991 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00128151 predicted 356
2 SASI_Hs01_00128152 predicted 267
3 SASI_Hs01_00128153 predicted 462
4 SASI_Hs01_00128154 predicted 859
5 SASI_Hs01_00128155 predicted 529
6 SASI_Hs01_00128156 predicted 541
7 SASI_Hs02_00348670 predicted 535
8 SASI_Hs01_00128158 predicted 291
9 SASI_Hs01_00128159 predicted 762
10 SASI_Hs02_00348671 predicted 539
11 SASI_Hs01_00128157 predicted 605
12 SASI_Hs01_00128160 predicted 551
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008515 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00049846 predicted 538
2 SASI_Rn01_00049847 predicted 695
3 SASI_Rn01_00049848 predicted 706
4 SASI_Rn01_00049849 predicted 219
5 SASI_Rn01_00049851 predicted 412
6 SASI_Rn01_00049852 predicted 512
7 SASI_Rn01_00049853 predicted 441
8 SASI_Rn01_00049854 predicted 588
9 SASI_Rn01_00049855 predicted 453
10 SASI_Rn02_00199196 predicted 580
11 SASI_Rn01_00049850 predicted 644
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007572 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00027923 predicted 402
2 SASI_Mm01_00027925 predicted 574
3 SASI_Mm01_00027927 predicted 474
4 SASI_Mm02_00311954 predicted 523
5 SASI_Mm01_00027928 predicted 597
6 SASI_Mm01_00027929 predicted 491
7 SASI_Mm02_00311955 predicted 568
8 SASI_Mm01_00027930 predicted 613
9 SASI_Mm01_00027931 predicted 461
10 SASI_Mm02_00311956 predicted 522
11 SASI_Mm01_00027924 predicted 537
12 SASI_Mm01_00027926 predicted 689
13 SASI_Mm01_00027932 predicted 547
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007572
C1QA MISSION shRNA Bacterial Glycerol Stock
complement component 1, q subcomponent, A chain
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000066481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007572.1-407s1c1
Sequence:CCGGGCTTGGCAACGTGGTTATCTTCTCGAGAAGATAACCACGTTGCCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007572.1-334s1c1
Sequence:CCGGTGAAAGGCAATCCAGGCAATACTCGAGTATTGCCTGGATTGCCTTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066478    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007572.1-497s1c1
Sequence:CCGGCGGCTTCTATTACTTCAACTTCTCGAGAAGTTGAAGTAATAGAAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007572.1-725s1c1
Sequence:CCGGCGACAGCATCTTCAGCGGATTCTCGAGAATCCGCTGAAGATGCTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007572.1-587s1c1
Sequence:CCGGCCTGAGTTTCTCTAACACCAACTCGAGTTGGTGTTAGAGAAACTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007572
C1QA MISSION shRNA shRNA Plasmid DNA
complement component 1, q subcomponent, A chain
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000066481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007572.1-407s1c1
Sequence:CCGGGCTTGGCAACGTGGTTATCTTCTCGAGAAGATAACCACGTTGCCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007572.1-334s1c1
Sequence:CCGGTGAAAGGCAATCCAGGCAATACTCGAGTATTGCCTGGATTGCCTTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066478    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007572.1-497s1c1
Sequence:CCGGCGGCTTCTATTACTTCAACTTCTCGAGAAGTTGAAGTAATAGAAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007572.1-725s1c1
Sequence:CCGGCGACAGCATCTTCAGCGGATTCTCGAGAATCCGCTGAAGATGCTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007572.1-587s1c1
Sequence:CCGGCCTGAGTTTCTCTAACACCAACTCGAGTTGGTGTTAGAGAAACTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007572
C1QA MISSION shRNA Lentiviral Transduction Particles
complement component 1, q subcomponent, A chain
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000066481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007572.1-407s1c1
Sequence:CCGGGCTTGGCAACGTGGTTATCTTCTCGAGAAGATAACCACGTTGCCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007572.1-334s1c1
Sequence:CCGGTGAAAGGCAATCCAGGCAATACTCGAGTATTGCCTGGATTGCCTTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066478    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007572.1-497s1c1
Sequence:CCGGCGGCTTCTATTACTTCAACTTCTCGAGAAGTTGAAGTAATAGAAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007572.1-725s1c1
Sequence:CCGGCGACAGCATCTTCAGCGGATTCTCGAGAATCCGCTGAAGATGCTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007572.1-587s1c1
Sequence:CCGGCCTGAGTTTCTCTAACACCAACTCGAGTTGGTGTTAGAGAAACTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015991
C1QA MISSION shRNA Bacterial Glycerol Stock
complement component 1, q subcomponent, A chain
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000057123    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015991.1-91s1c1
Sequence:CCGGCGAGCACCAGACGGGAAGAAACTCGAGTTTCTTCCCGTCTGGTGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015991.1-193s1c1
Sequence:CCGGACAGGCATCCAAGGCCTTAAACTCGAGTTTAAGGCCTTGGATGCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015991.1-480s1c1
Sequence:CCGGCGGCTACTACTACTTCACCTTCTCGAGAAGGTGAAGTAGTAGTAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015991.1-300s1c1
Sequence:CCGGCCCGGGAATTAAAGGCACCAACTCGAGTTGGTGCCTTTAATTCCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015991.1-429s1c1
Sequence:CCGGCCAGGAAGAACCGTACCAGAACTCGAGTTCTGGTACGGTTCTTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000377671    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015991.2-861s21c1
Sequence:CCGGCTTCCATGCTCCGCCTGTAAACTCGAGTTTACAGGCGGAGCATGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371456    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015991.2-111s21c1
Sequence:CCGGTGCTCTGTGTGCTGGCCATATCTCGAGATATGGCCAGCACACAGAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015991.2-139s21c1
Sequence:CCGGCTCTATGGTGACCGAGGACTTCTCGAGAAGTCCTCGGTCACCATAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015991
C1QA MISSION shRNA shRNA Plasmid DNA
complement component 1, q subcomponent, A chain
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000057123    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015991.1-91s1c1
Sequence:CCGGCGAGCACCAGACGGGAAGAAACTCGAGTTTCTTCCCGTCTGGTGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015991.1-193s1c1
Sequence:CCGGACAGGCATCCAAGGCCTTAAACTCGAGTTTAAGGCCTTGGATGCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015991.1-480s1c1
Sequence:CCGGCGGCTACTACTACTTCACCTTCTCGAGAAGGTGAAGTAGTAGTAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015991.1-300s1c1
Sequence:CCGGCCCGGGAATTAAAGGCACCAACTCGAGTTGGTGCCTTTAATTCCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015991.1-429s1c1
Sequence:CCGGCCAGGAAGAACCGTACCAGAACTCGAGTTCTGGTACGGTTCTTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000377671    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015991.2-861s21c1
Sequence:CCGGCTTCCATGCTCCGCCTGTAAACTCGAGTTTACAGGCGGAGCATGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371456    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015991.2-111s21c1
Sequence:CCGGTGCTCTGTGTGCTGGCCATATCTCGAGATATGGCCAGCACACAGAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015991.2-139s21c1
Sequence:CCGGCTCTATGGTGACCGAGGACTTCTCGAGAAGTCCTCGGTCACCATAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015991
C1QA MISSION shRNA Lentiviral Transduction Particles
complement component 1, q subcomponent, A chain
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000057123    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015991.1-91s1c1
Sequence:CCGGCGAGCACCAGACGGGAAGAAACTCGAGTTTCTTCCCGTCTGGTGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015991.1-193s1c1
Sequence:CCGGACAGGCATCCAAGGCCTTAAACTCGAGTTTAAGGCCTTGGATGCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015991.1-480s1c1
Sequence:CCGGCGGCTACTACTACTTCACCTTCTCGAGAAGGTGAAGTAGTAGTAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015991.1-300s1c1
Sequence:CCGGCCCGGGAATTAAAGGCACCAACTCGAGTTGGTGCCTTTAATTCCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015991.1-429s1c1
Sequence:CCGGCCAGGAAGAACCGTACCAGAACTCGAGTTCTGGTACGGTTCTTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000377671    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015991.2-861s21c1
Sequence:CCGGCTTCCATGCTCCGCCTGTAAACTCGAGTTTACAGGCGGAGCATGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371456    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015991.2-111s21c1
Sequence:CCGGTGCTCTGTGTGCTGGCCATATCTCGAGATATGGCCAGCACACAGAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015991.2-139s21c1
Sequence:CCGGCTCTATGGTGACCGAGGACTTCTCGAGAAGTCCTCGGTCACCATAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks