EMAIL THIS PAGE TO A FRIEND

C1QB

complement component 1, q subcomponent, B chain

70 Gene Product Result for
UniProtKB ID: P02746, Q5T959, Q96H17
Gene ID:
Human(713) Summary: This gene encodes a major constituent of the human complement subcomponent C1q. C1q associates with C1r and C1s in order to yield the first component of the serum complement system. Deficiency of C1q has been associated with lupus erythematosus and glomerulonephritis. C1q is composed of 18 polypeptide chains: six A-chains, six B-chains, and six C-chains. Each chain contains a collagen-like region located near the N terminus and a C-terminal globular region. The A-, B-, and C-chains are arranged in the order A-C-B on chromosome 1. This gene encodes the B-chain polypeptide of human complement subcomponent C1q [provided by RefSeq, Jul 2008]
Mouse(12260) complement component 1, q subcomponent, beta polypeptide
Rat(29687) complement component 1, q subcomponent, B chain
sheep(101123189) complement component 1, q subcomponent, B chain
naked mole-rat(101704691) complement component 1, q subcomponent, B chain
domestic guinea pig(100715803) complement component 1, q subcomponent, B chain
Zebrafish(445088) complement component 1, q subcomponent, B chain
domestic cat(101096331) complement component 1, q subcomponent, B chain
cow(617435) complement component 1, q subcomponent, B chain
dog(487381) complement component 1, q subcomponent, B chain
chicken(428197) complement component 1, q subcomponent, B chain
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000491 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000491 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000491 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009777 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009777 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009777 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU133411 MISSION® esiRNA esiRNA human C1QB (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000491 Rosetta Predictions human pricing
NM_019262 Rosetta Predictions rat pricing
NM_009777 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000491 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00195886 predicted 706
2 SASI_Hs01_00195887 predicted 657
3 SASI_Hs02_00302646 predicted 698
4 SASI_Hs01_00195888 predicted 712
5 SASI_Hs01_00195889 predicted 562
6 SASI_Hs01_00195890 predicted 608
7 SASI_Hs01_00195892 predicted 664
8 SASI_Hs01_00195893 predicted 610
9 SASI_Hs01_00195894 predicted 557
10 SASI_Hs02_00302647 predicted 721
11 SASI_Hs01_00195891 predicted 729
12 SASI_Hs01_00195895 predicted 614
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019262 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00101845 predicted 668
2 SASI_Rn01_00101846 predicted 705
3 SASI_Rn01_00101847 predicted 614
4 SASI_Rn02_00262145 predicted 642
5 SASI_Rn01_00101848 predicted 759
6 SASI_Rn01_00101849 predicted 519
7 SASI_Rn01_00101850 predicted 768
8 SASI_Rn01_00101851 predicted 651
9 SASI_Rn01_00101852 predicted 516
10 SASI_Rn01_00101853 predicted 587
11 SASI_Rn01_00101854 predicted 705
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009777 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00131527 predicted 638
2 SASI_Mm01_00131528 predicted 646
3 SASI_Mm02_00317001 predicted 749
4 SASI_Mm01_00131529 predicted 550
5 SASI_Mm01_00131531 predicted 561
6 SASI_Mm01_00131532 predicted 674
7 SASI_Mm02_00317002 predicted 740
8 SASI_Mm02_00317003 predicted 724
9 SASI_Mm01_00131534 predicted 639
10 SASI_Mm02_00317004 predicted 727
11 SASI_Mm01_00131530 predicted 360
12 SASI_Mm01_00131533 predicted 636
13 SASI_Mm01_00131535 predicted 610
14 SASI_Mm01_00131536 predicted 548
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000491
C1QB MISSION shRNA Bacterial Glycerol Stock
complement component 1, q subcomponent, B chain
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000377670    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000491.3-183s21c1
Sequence:CCGGGCTCCTGGGCCTAATCGATATCTCGAGATATCGATTAGGCCCAGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000491.3-666s21c1
Sequence:CCGGGAACCTGTGCGTGAACCTCATCTCGAGATGAGGTTCACGCACAGGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371515    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000491.3-857s21c1
Sequence:CCGGTTTCCGGGTTCCTGCTCTTTCCTCGAGGAAAGAGCAGGAACCCGGAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000491.2-390s1c1
Sequence:CCGGCAAAGGTGAATCGGGAGACTACTCGAGTAGTCTCCCGATTCACCTTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000491.2-558s1c1
Sequence:CCGGCGGTCTCTACTACTTCACCTACTCGAGTAGGTGAAGTAGTAGAGACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000491.2-739s1c1
Sequence:CCGGGCCACCGACAAGAACTCACTACTCGAGTAGTGAGTTCTTGTCGGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000491.2-495s1c1
Sequence:CCGGCGTGATCACCAACATGAACAACTCGAGTTGTTCATGTTGGTGATCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000491.2-643s1c1
Sequence:CCGGGTGGTCACCTTCTGTGACTATCTCGAGATAGTCACAGAAGGTGACCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000491
C1QB MISSION shRNA shRNA Plasmid DNA
complement component 1, q subcomponent, B chain
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000377670    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000491.3-183s21c1
Sequence:CCGGGCTCCTGGGCCTAATCGATATCTCGAGATATCGATTAGGCCCAGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000371516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000491.3-666s21c1
Sequence:CCGGGAACCTGTGCGTGAACCTCATCTCGAGATGAGGTTCACGCACAGGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000371515    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000491.3-857s21c1
Sequence:CCGGTTTCCGGGTTCCTGCTCTTTCCTCGAGGAAAGAGCAGGAACCCGGAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000491.2-390s1c1
Sequence:CCGGCAAAGGTGAATCGGGAGACTACTCGAGTAGTCTCCCGATTCACCTTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000491.2-558s1c1
Sequence:CCGGCGGTCTCTACTACTTCACCTACTCGAGTAGGTGAAGTAGTAGAGACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000491.2-739s1c1
Sequence:CCGGGCCACCGACAAGAACTCACTACTCGAGTAGTGAGTTCTTGTCGGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000491.2-495s1c1
Sequence:CCGGCGTGATCACCAACATGAACAACTCGAGTTGTTCATGTTGGTGATCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000491.2-643s1c1
Sequence:CCGGGTGGTCACCTTCTGTGACTATCTCGAGATAGTCACAGAAGGTGACCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000491
C1QB MISSION shRNA Lentiviral Transduction Particles
complement component 1, q subcomponent, B chain
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000377670    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000491.3-183s21c1
Sequence:CCGGGCTCCTGGGCCTAATCGATATCTCGAGATATCGATTAGGCCCAGGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000491.3-666s21c1
Sequence:CCGGGAACCTGTGCGTGAACCTCATCTCGAGATGAGGTTCACGCACAGGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371515    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000491.3-857s21c1
Sequence:CCGGTTTCCGGGTTCCTGCTCTTTCCTCGAGGAAAGAGCAGGAACCCGGAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000491.2-390s1c1
Sequence:CCGGCAAAGGTGAATCGGGAGACTACTCGAGTAGTCTCCCGATTCACCTTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000491.2-558s1c1
Sequence:CCGGCGGTCTCTACTACTTCACCTACTCGAGTAGGTGAAGTAGTAGAGACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000491.2-739s1c1
Sequence:CCGGGCCACCGACAAGAACTCACTACTCGAGTAGTGAGTTCTTGTCGGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000491.2-495s1c1
Sequence:CCGGCGTGATCACCAACATGAACAACTCGAGTTGTTCATGTTGGTGATCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000491.2-643s1c1
Sequence:CCGGGTGGTCACCTTCTGTGACTATCTCGAGATAGTCACAGAAGGTGACCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009777
C1QB MISSION shRNA Bacterial Glycerol Stock
complement component 1, q subcomponent, B chain
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000066533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009777.1-187s1c1
Sequence:CCGGCACCTGTTACTGCTGCTTCTACTCGAGTAGAAGCAGCAGTAACAGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009777.1-870s1c1
Sequence:CCGGCAACAGCATCTTCACTGGCTTCTCGAGAAGCCAGTGAAGATGCTGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009777.1-649s1c1
Sequence:CCGGCTCTACTACTTCACCTATCATCTCGAGATGATAGGTGAAGTAGTAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009777.1-790s1c1
Sequence:CCGGGTAGTCTTGAAGCTAGAGCAACTCGAGTTGCTCTAGCTTCAAGACTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009777.1-361s1c1
Sequence:CCGGCTTGGTGAGTTTGGAGAGAAACTCGAGTTTCTCTCCAAACTCACCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009777
C1QB MISSION shRNA shRNA Plasmid DNA
complement component 1, q subcomponent, B chain
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000066533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009777.1-187s1c1
Sequence:CCGGCACCTGTTACTGCTGCTTCTACTCGAGTAGAAGCAGCAGTAACAGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009777.1-870s1c1
Sequence:CCGGCAACAGCATCTTCACTGGCTTCTCGAGAAGCCAGTGAAGATGCTGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009777.1-649s1c1
Sequence:CCGGCTCTACTACTTCACCTATCATCTCGAGATGATAGGTGAAGTAGTAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009777.1-790s1c1
Sequence:CCGGGTAGTCTTGAAGCTAGAGCAACTCGAGTTGCTCTAGCTTCAAGACTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009777.1-361s1c1
Sequence:CCGGCTTGGTGAGTTTGGAGAGAAACTCGAGTTTCTCTCCAAACTCACCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009777
C1QB MISSION shRNA Lentiviral Transduction Particles
complement component 1, q subcomponent, B chain
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000066533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009777.1-187s1c1
Sequence:CCGGCACCTGTTACTGCTGCTTCTACTCGAGTAGAAGCAGCAGTAACAGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009777.1-870s1c1
Sequence:CCGGCAACAGCATCTTCACTGGCTTCTCGAGAAGCCAGTGAAGATGCTGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009777.1-649s1c1
Sequence:CCGGCTCTACTACTTCACCTATCATCTCGAGATGATAGGTGAAGTAGTAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009777.1-790s1c1
Sequence:CCGGGTAGTCTTGAAGCTAGAGCAACTCGAGTTGCTCTAGCTTCAAGACTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009777.1-361s1c1
Sequence:CCGGCTTGGTGAGTTTGGAGAGAAACTCGAGTTTCTCTCCAAACTCACCAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)