EMAIL THIS PAGE TO A FRIEND

C1QBP

complement component 1, q subcomponent binding protein

58 Gene Product Result for
Synonyms: GC1QBP HABP1 SF2p32 gC1Q-R gC1qR p32
UniProtKB ID: Q07021, Q2HXR8, Q9NNY8
Gene ID:
Human(708) Summary: The human complement subcomponent C1q associates with C1r and C1s in order to yield the first component of the serum complement system. The protein encoded by this gene is known to bind to the globular heads of C1q molecules and inhibit C1 activation. This protein has also been identified as the p32 subunit of pre-mRNA splicing factor SF2, as well as a hyaluronic acid-binding protein. [provided by RefSeq, Jul 2008]
Mouse(12261) complement component 1, q subcomponent binding protein
Rat(29681) complement component 1, q subcomponent binding protein
Zebrafish(334619) complement component 1, q subcomponent binding protein
cow(518321) complement component 1, q subcomponent binding protein
domestic cat(101089553) complement component 1, q subcomponent binding protein
dog(489450) complement component 1, q subcomponent binding protein
chicken(395538) complement component 1, q subcomponent binding protein
domestic guinea pig(100725900) complement component 1, q subcomponent binding protein
naked mole-rat(101698035) complement component 1, q subcomponent binding protein
sheep(101106021) complement component 1, q subcomponent binding protein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001212 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001212 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001212 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007573 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007573 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007573 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001212 Rosetta Predictions human pricing
NM_019259 Rosetta Predictions rat pricing
NM_007573 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001212 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00127907 predicted 627
2 SASI_Hs01_00127908 predicted 411
3 SASI_Hs01_00127909 predicted 484
4 SASI_Hs01_00127910 predicted 776
5 SASI_Hs01_00127911 predicted 724
6 SASI_Hs01_00127912 predicted 731
7 SASI_Hs01_00127914 predicted 698
8 SASI_Hs01_00127915 predicted 776
9 SASI_Hs01_00127916 predicted 601
10 SASI_Hs02_00331355 predicted 424
11 SASI_Hs01_00127913 predicted 916
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019259 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00090573 predicted 324
2 SASI_Rn01_00090574 predicted 354
3 SASI_Rn01_00090575 predicted 308
4 SASI_Rn01_00090576 predicted 635
5 SASI_Rn01_00090577 predicted 526
6 SASI_Rn01_00090578 predicted 837
7 SASI_Rn01_00090579 predicted 781
8 SASI_Rn02_00262144 predicted 642
9 SASI_Rn01_00090580 predicted 336
10 SASI_Rn01_00090581 predicted 851
11 SASI_Rn01_00090582 predicted 748
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007573 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00083395 predicted 721
2 SASI_Mm01_00083396 predicted 712
3 SASI_Mm01_00083397 predicted 314
4 SASI_Mm01_00083399 predicted 628
5 SASI_Mm02_00311957 predicted 725
6 SASI_Mm01_00083400 predicted 852
7 SASI_Mm01_00083401 predicted 417
8 SASI_Mm01_00083402 predicted 685
9 SASI_Mm01_00083403 predicted 895
10 SASI_Mm02_00311958 predicted 629
11 SASI_Mm01_00083398 predicted 494
12 SASI_Mm01_00083404 predicted 516
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001212
VALIDATED
C1QBP MISSION shRNA Bacterial Glycerol Stock
complement component 1, q subcomponent binding protein
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000057103    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_001212.3-574s1c1
Sequence:CCGGCCCAATTTCGTGGTTGAAGTTCTCGAGAACTTCAACCACGAAATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_001212.3-430s1c1
Sequence:CCGGGCGAAATTAGTGCGGAAAGTTCTCGAGAACTTTCCGCACTAATTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057106    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_001212.3-870s1c1
Sequence:CCGGGCACCAGGAGTACATTACTTTCTCGAGAAAGTAATGTACTCCTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_001212.3-338s1c1
Sequence:CCGGGTGATGAAATTAAGGAGGAAACTCGAGTTTCCTCCTTAATTTCATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370164    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_001212.3-767s21c1
Sequence:CCGGCCTTGGACTGGGCCTTATATGCTCGAGCATATAAGGCCCAGTCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300657    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_001212.3-870s21c1
Sequence:CCGGGCACCAGGAGTACATTACTTTCTCGAGAAAGTAATGTACTCCTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300658    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_001212.3-574s21c1
Sequence:CCGGCCCAATTTCGTGGTTGAAGTTCTCGAGAACTTCAACCACGAAATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_001212.3-338s21c1
Sequence:CCGGGTGATGAAATTAAGGAGGAAACTCGAGTTTCCTCCTTAATTTCATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370165    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_001212.3-727s21c1
Sequence:CCGGTCTGAATGGAAGGATACTAATCTCGAGATTAGTATCCTTCCATTCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001212
VALIDATED
C1QBP MISSION shRNA shRNA Plasmid DNA
complement component 1, q subcomponent binding protein
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000057103    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_001212.3-574s1c1
Sequence:CCGGCCCAATTTCGTGGTTGAAGTTCTCGAGAACTTCAACCACGAAATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_001212.3-430s1c1
Sequence:CCGGGCGAAATTAGTGCGGAAAGTTCTCGAGAACTTTCCGCACTAATTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057106    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_001212.3-870s1c1
Sequence:CCGGGCACCAGGAGTACATTACTTTCTCGAGAAAGTAATGTACTCCTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_001212.3-338s1c1
Sequence:CCGGGTGATGAAATTAAGGAGGAAACTCGAGTTTCCTCCTTAATTTCATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370164    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_001212.3-767s21c1
Sequence:CCGGCCTTGGACTGGGCCTTATATGCTCGAGCATATAAGGCCCAGTCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300657    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_001212.3-870s21c1
Sequence:CCGGGCACCAGGAGTACATTACTTTCTCGAGAAAGTAATGTACTCCTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300658    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_001212.3-574s21c1
Sequence:CCGGCCCAATTTCGTGGTTGAAGTTCTCGAGAACTTCAACCACGAAATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_001212.3-338s21c1
Sequence:CCGGGTGATGAAATTAAGGAGGAAACTCGAGTTTCCTCCTTAATTTCATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370165    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_001212.3-727s21c1
Sequence:CCGGTCTGAATGGAAGGATACTAATCTCGAGATTAGTATCCTTCCATTCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001212
VALIDATED
C1QBP MISSION shRNA Lentiviral Transduction Particles
complement component 1, q subcomponent binding protein
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000057103    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_001212.3-574s1c1
Sequence:CCGGCCCAATTTCGTGGTTGAAGTTCTCGAGAACTTCAACCACGAAATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_001212.3-430s1c1
Sequence:CCGGGCGAAATTAGTGCGGAAAGTTCTCGAGAACTTTCCGCACTAATTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057106    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_001212.3-870s1c1
Sequence:CCGGGCACCAGGAGTACATTACTTTCTCGAGAAAGTAATGTACTCCTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_001212.3-338s1c1
Sequence:CCGGGTGATGAAATTAAGGAGGAAACTCGAGTTTCCTCCTTAATTTCATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370164    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_001212.3-767s21c1
Sequence:CCGGCCTTGGACTGGGCCTTATATGCTCGAGCATATAAGGCCCAGTCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300657    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_001212.3-870s21c1
Sequence:CCGGGCACCAGGAGTACATTACTTTCTCGAGAAAGTAATGTACTCCTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300658    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_001212.3-574s21c1
Sequence:CCGGCCCAATTTCGTGGTTGAAGTTCTCGAGAACTTCAACCACGAAATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_001212.3-338s21c1
Sequence:CCGGGTGATGAAATTAAGGAGGAAACTCGAGTTTCCTCCTTAATTTCATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370165    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_001212.3-727s21c1
Sequence:CCGGTCTGAATGGAAGGATACTAATCTCGAGATTAGTATCCTTCCATTCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007573
C1QBP MISSION shRNA Bacterial Glycerol Stock
complement component 1, q subcomponent binding protein
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000066596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007573.1-499s1c1
Sequence:CCGGCGGACATCAACTCCCAACTTTCTCGAGAAAGTTGGGAGTTGATGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007573.1-319s1c1
Sequence:CCGGCTTCCCAAGATGTCTGGAGATCTCGAGATCTCCAGACATCTTGGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007573.1-511s1c1
Sequence:CCGGCCCAACTTTGTGGTTGAAGTTCTCGAGAACTTCAACCACAAAGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007573.1-804s1c1
Sequence:CCGGGCACCAGGAATATATCACCTTCTCGAGAAGGTGATATATTCCTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007573.1-367s1c1
Sequence:CCGGGCTAAATTATTGCGCAAAGTTCTCGAGAACTTTGCGCAATAATTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007573
C1QBP MISSION shRNA shRNA Plasmid DNA
complement component 1, q subcomponent binding protein
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000066596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007573.1-499s1c1
Sequence:CCGGCGGACATCAACTCCCAACTTTCTCGAGAAAGTTGGGAGTTGATGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007573.1-319s1c1
Sequence:CCGGCTTCCCAAGATGTCTGGAGATCTCGAGATCTCCAGACATCTTGGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007573.1-511s1c1
Sequence:CCGGCCCAACTTTGTGGTTGAAGTTCTCGAGAACTTCAACCACAAAGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007573.1-804s1c1
Sequence:CCGGGCACCAGGAATATATCACCTTCTCGAGAAGGTGATATATTCCTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007573.1-367s1c1
Sequence:CCGGGCTAAATTATTGCGCAAAGTTCTCGAGAACTTTGCGCAATAATTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007573
C1QBP MISSION shRNA Lentiviral Transduction Particles
complement component 1, q subcomponent binding protein
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000066596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007573.1-499s1c1
Sequence:CCGGCGGACATCAACTCCCAACTTTCTCGAGAAAGTTGGGAGTTGATGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007573.1-319s1c1
Sequence:CCGGCTTCCCAAGATGTCTGGAGATCTCGAGATCTCCAGACATCTTGGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007573.1-511s1c1
Sequence:CCGGCCCAACTTTGTGGTTGAAGTTCTCGAGAACTTCAACCACAAAGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007573.1-804s1c1
Sequence:CCGGGCACCAGGAATATATCACCTTCTCGAGAAGGTGATATATTCCTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007573.1-367s1c1
Sequence:CCGGGCTAAATTATTGCGCAAAGTTCTCGAGAACTTTGCGCAATAATTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks