EMAIL THIS PAGE TO A FRIEND

C1QC

complement component 1, q subcomponent, C chain

62 Gene Product Result for
Synonyms: C1Q-C C1QG
UniProtKB ID: P02747, Q7Z502, Q96DL2, Q96H05
Gene ID:
Human(714) Summary: This gene encodes a major constituent of the human complement subcomponent C1q. C1q associates with C1r and C1s in order to yield the first component of the serum complement system. A deficiency in C1q has been associated with lupus erythematosus and glomerulonephritis. C1q is composed of 18 polypeptide chains: six A-chains, six B-chains, and six C-chains. Each chain contains a collagen-like region located near the N-terminus, and a C-terminal globular region. The A-, B-, and C-chains are arranged in the order A-C-B on chromosome 1. This gene encodes the C-chain polypeptide of human complement subcomponent C1q. Alternatively spliced transcript variants that encode the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(12262) complement component 1, q subcomponent, C chain
Rat(362634) complement component 1, q subcomponent, C chain
Zebrafish(449803) complement component 1, q subcomponent, C chain
chicken(419503) complement component 1, q subcomponent, C chain
dog(487382) complement component 1, q subcomponent, C chain
cow(509968) complement component 1, q subcomponent, C chain
domestic cat(101094773) complement component 1, q subcomponent, C chain
sheep(101101871) complement component 1, q subcomponent, C chain
naked mole-rat(101704347) complement component 1, q subcomponent, C chain
domestic guinea pig(100716082) complement component 1, q subcomponent, C chain
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172369 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_172369 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_172369 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007574 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007574 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007574 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU150221 MISSION® esiRNA esiRNA human C1QC (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001114101 Rosetta Predictions human pricing
NM_172369 Rosetta Predictions human pricing
NM_001008524 Rosetta Predictions rat pricing
NM_007574 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001114101 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00326234 predicted 479
2 SASI_Hs02_00326235 predicted 456
3 SASI_Hs02_00326236 predicted 546
4 SASI_Hs02_00326237 predicted 450
5 SASI_Hs02_00326238 predicted 459
6 SASI_Hs02_00326239 predicted 480
7 SASI_Hs02_00326240 predicted 449
8 SASI_Hs02_00326241 predicted 629
9 SASI_Hs02_00326242 predicted 611
10 SASI_Hs02_00326243 predicted 520
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172369 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00156279 predicted 452
2 SASI_Hs01_00156282 predicted 434
3 SASI_Hs01_00156284 predicted 532
4 SASI_Hs02_00368021 predicted 432
5 SASI_Hs02_00368022 predicted 432
6 SASI_Hs02_00368023 predicted 453
7 SASI_Hs01_00156278 predicted 424
8 SASI_Hs02_00368024 predicted 598
9 SASI_Hs01_00156280 predicted 585
10 SASI_Hs01_00156283 predicted 499
11 SASI_Hs01_00156281 predicted 396
12 SASI_Hs01_00156285 predicted 475
13 SASI_Hs01_00156286 predicted 471
14 SASI_Hs01_00156287 predicted 567
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008524 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00199213 predicted 619
2 SASI_Rn01_00037196 predicted 508
3 SASI_Rn01_00037197 predicted 345
4 SASI_Rn01_00037199 predicted 416
5 SASI_Rn01_00037201 predicted 222
6 SASI_Rn01_00037202 predicted 416
7 SASI_Rn01_00037203 predicted 595
8 SASI_Rn01_00037204 predicted 491
9 SASI_Rn02_00199214 predicted 725
10 SASI_Rn01_00037205 predicted 223
11 SASI_Rn01_00037198 predicted 428
12 SASI_Rn01_00037200 predicted 431
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007574 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00130820 predicted 721
2 SASI_Mm01_00130821 predicted 531
3 SASI_Mm01_00130822 predicted 398
4 SASI_Mm01_00130823 predicted 571
5 SASI_Mm02_00311959 predicted 712
6 SASI_Mm01_00130825 predicted 782
7 SASI_Mm01_00130826 predicted 397
8 SASI_Mm01_00130827 predicted 757
9 SASI_Mm01_00130828 predicted 595
10 SASI_Mm01_00130824 predicted 714
11 SASI_Mm01_00130829 predicted 764
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172369
C1QC MISSION shRNA Bacterial Glycerol Stock
complement component 1, q subcomponent, C chain
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000371518    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172369.3-921s21c1
Sequence:CCGGGCATCCTTGCCTAGACCATTCCTCGAGGAATGGTCTAGGCAAGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371457    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172369.3-503s21c1
Sequence:CCGGCCCAACAGCCTGATCAGATTCCTCGAGGAATCTGATCAGGCTGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371458    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172369.3-536s21c1
Sequence:CCGGACCAACCCGCAGGGAGATTATCTCGAGATAATCTCCCTGCGGGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172369.1-772s1c1
Sequence:CCGGGCTGGCTGTCAATGACTACTACTCGAGTAGTAGTCATTGACAGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172369.1-449s1c1
Sequence:CCGGGAGGGCAGATACAAGCAGAAACTCGAGTTTCTGCTTGTATCTGCCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172369.1-610s1c1
Sequence:CCGGCCTCTACTACTTTGTCTACCACTCGAGTGGTAGACAAAGTAGTAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172369.1-673s1c1
Sequence:CCGGCGGCGTCAAAGTGGTCACCTTCTCGAGAAGGTGACCACTTTGACGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172369.1-196s1c1
Sequence:CCGGCCAAGCCAACACAGGCTGCTACTCGAGTAGCAGCCTGTGTTGGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172369
C1QC MISSION shRNA shRNA Plasmid DNA
complement component 1, q subcomponent, C chain
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000371518    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172369.3-921s21c1
Sequence:CCGGGCATCCTTGCCTAGACCATTCCTCGAGGAATGGTCTAGGCAAGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371457    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172369.3-503s21c1
Sequence:CCGGCCCAACAGCCTGATCAGATTCCTCGAGGAATCTGATCAGGCTGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371458    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172369.3-536s21c1
Sequence:CCGGACCAACCCGCAGGGAGATTATCTCGAGATAATCTCCCTGCGGGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172369.1-772s1c1
Sequence:CCGGGCTGGCTGTCAATGACTACTACTCGAGTAGTAGTCATTGACAGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172369.1-449s1c1
Sequence:CCGGGAGGGCAGATACAAGCAGAAACTCGAGTTTCTGCTTGTATCTGCCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172369.1-610s1c1
Sequence:CCGGCCTCTACTACTTTGTCTACCACTCGAGTGGTAGACAAAGTAGTAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172369.1-673s1c1
Sequence:CCGGCGGCGTCAAAGTGGTCACCTTCTCGAGAAGGTGACCACTTTGACGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172369.1-196s1c1
Sequence:CCGGCCAAGCCAACACAGGCTGCTACTCGAGTAGCAGCCTGTGTTGGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172369
C1QC MISSION shRNA Lentiviral Transduction Particles
complement component 1, q subcomponent, C chain
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000371518    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172369.3-921s21c1
Sequence:CCGGGCATCCTTGCCTAGACCATTCCTCGAGGAATGGTCTAGGCAAGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371457    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172369.3-503s21c1
Sequence:CCGGCCCAACAGCCTGATCAGATTCCTCGAGGAATCTGATCAGGCTGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371458    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172369.3-536s21c1
Sequence:CCGGACCAACCCGCAGGGAGATTATCTCGAGATAATCTCCCTGCGGGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172369.1-772s1c1
Sequence:CCGGGCTGGCTGTCAATGACTACTACTCGAGTAGTAGTCATTGACAGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172369.1-449s1c1
Sequence:CCGGGAGGGCAGATACAAGCAGAAACTCGAGTTTCTGCTTGTATCTGCCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172369.1-610s1c1
Sequence:CCGGCCTCTACTACTTTGTCTACCACTCGAGTGGTAGACAAAGTAGTAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172369.1-673s1c1
Sequence:CCGGCGGCGTCAAAGTGGTCACCTTCTCGAGAAGGTGACCACTTTGACGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172369.1-196s1c1
Sequence:CCGGCCAAGCCAACACAGGCTGCTACTCGAGTAGCAGCCTGTGTTGGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007574
C1QC MISSION shRNA Bacterial Glycerol Stock
complement component 1, q subcomponent, C chain
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000066648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007574.1-695s1c1
Sequence:CCGGGCTATCAGTCAATGACTACAACTCGAGTTGTAGTCATTGACTGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007574.1-174s1c1
Sequence:CCGGCCTGGGAAGGACGGGCATGATCTCGAGATCATGCCCGTCCTTCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007574.1-620s1c1
Sequence:CCGGCGACCACATGTTCAACAGCAACTCGAGTTGCTGTTGAACATGTGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007574.1-504s1c1
Sequence:CCGGACAGGGAAGTTCACCTGTGAACTCGAGTTCACAGGTGAACTTCCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007574.1-749s1c1
Sequence:CCGGCTTCTCTGGTTTCCTACTGTTCTCGAGAACAGTAGGAAACCAGAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007574
C1QC MISSION shRNA shRNA Plasmid DNA
complement component 1, q subcomponent, C chain
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000066648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007574.1-695s1c1
Sequence:CCGGGCTATCAGTCAATGACTACAACTCGAGTTGTAGTCATTGACTGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007574.1-174s1c1
Sequence:CCGGCCTGGGAAGGACGGGCATGATCTCGAGATCATGCCCGTCCTTCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007574.1-620s1c1
Sequence:CCGGCGACCACATGTTCAACAGCAACTCGAGTTGCTGTTGAACATGTGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007574.1-504s1c1
Sequence:CCGGACAGGGAAGTTCACCTGTGAACTCGAGTTCACAGGTGAACTTCCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007574.1-749s1c1
Sequence:CCGGCTTCTCTGGTTTCCTACTGTTCTCGAGAACAGTAGGAAACCAGAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007574
C1QC MISSION shRNA Lentiviral Transduction Particles
complement component 1, q subcomponent, C chain
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000066648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007574.1-695s1c1
Sequence:CCGGGCTATCAGTCAATGACTACAACTCGAGTTGTAGTCATTGACTGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007574.1-174s1c1
Sequence:CCGGCCTGGGAAGGACGGGCATGATCTCGAGATCATGCCCGTCCTTCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007574.1-620s1c1
Sequence:CCGGCGACCACATGTTCAACAGCAACTCGAGTTGCTGTTGAACATGTGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007574.1-504s1c1
Sequence:CCGGACAGGGAAGTTCACCTGTGAACTCGAGTTCACAGGTGAACTTCCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007574.1-749s1c1
Sequence:CCGGCTTCTCTGGTTTCCTACTGTTCTCGAGAACAGTAGGAAACCAGAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks