EMAIL THIS PAGE TO A FRIEND

C1QL1

complement component 1, q subcomponent-like 1

42 Gene Product Result for
Synonyms: C1QRF C1QTNF14 CRF
UniProtKB ID: O75973
Gene ID:
Mouse(23829) complement component 1, q subcomponent-like 1
Rat(363686) complement component 1, q subcomponent-like 1
domestic guinea pig(100720125) complement component 1, q subcomponent-like 1
naked mole-rat(101707159) complement component 1, q subcomponent-like 1
cow(519675) complement component 1, q subcomponent-like 1
domestic cat(101086269) complement component 1, q subcomponent-like 1
dog(490931) complement component 1, q subcomponent-like 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011795 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011795 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011795 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006688 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006688 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006688 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU190261 MISSION® esiRNA esiRNA targeting mouse C1ql1 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006688 Rosetta Predictions human pricing
NM_001108838 Rosetta Predictions rat pricing
NM_011795 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006688 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00120532 predicted 897
2 SASI_Hs01_00120533 predicted 943
3 SASI_Hs01_00120534 predicted 815
4 SASI_Hs01_00120535 predicted 793
5 SASI_Hs01_00120536 predicted 951
6 SASI_Hs01_00120537 predicted 971
7 SASI_Hs01_00120538 predicted 782
8 SASI_Hs01_00120539 predicted 968
9 SASI_Hs01_00120540 predicted 921
10 SASI_Hs01_00120541 predicted 1159
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108838 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00242575 predicted 672
2 SASI_Rn02_00242576 predicted 842
3 SASI_Rn02_00242577 predicted 482
4 SASI_Rn02_00242578 predicted 387
5 SASI_Rn02_00242579 predicted 672
6 SASI_Rn02_00242580 predicted 923
7 SASI_Rn02_00242581 predicted 502
8 SASI_Rn02_00242582 predicted 975
9 SASI_Rn02_00242583 predicted 647
10 SASI_Rn02_00242584 predicted 726
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011795 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00062695 predicted 544
2 SASI_Mm01_00062696 predicted 368
3 SASI_Mm01_00062697 predicted 342
4 SASI_Mm01_00062698 predicted 413
5 SASI_Mm01_00062699 predicted 488
6 SASI_Mm01_00062700 predicted 473
7 SASI_Mm01_00062701 predicted 504
8 SASI_Mm01_00062702 predicted 478
9 SASI_Mm01_00062703 predicted 500
10 SASI_Mm01_00062704 predicted 488
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011795
C1QL1 MISSION shRNA Bacterial Glycerol Stock
complement component 1, q subcomponent-like 1
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000114100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011795.1-558s1c1
Sequence:CCGGCGGCACCAGTATGTGGGCAGACTCGAGTCTGCCCACATACTGGTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011795.1-489s1c1
Sequence:CCGGCGGCAAGTTTACATGCAACATCTCGAGATGTTGCATGTAAACTTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011795.1-625s1c1
Sequence:CCGGGCAGACCAGAACTACGACTATCTCGAGATAGTCGTAGTTCTGGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011795.1-353s1c1
Sequence:CCGGCCATCAGCACGGCCACCTATACTCGAGTATAGGTGGCCGTGCTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000446067    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011795.2-939s21c1
Sequence:CCGGTTTCCTCCGCTGAACACAAAGCTCGAGCTTTGTGTTCAGCGGAGGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000439984    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011795.2-760s21c1
Sequence:CCGGATCATCTACTCGGATTGAGCCCTCGAGGGCTCAATCCGAGTAGATGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011795.2-730s21c1
Sequence:CCGGAGCAACAAATACAGCACTTTCCTCGAGGAAAGTGCTGTATTTGTTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011795
C1QL1 MISSION shRNA shRNA Plasmid DNA
complement component 1, q subcomponent-like 1
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000114100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011795.1-558s1c1
Sequence:CCGGCGGCACCAGTATGTGGGCAGACTCGAGTCTGCCCACATACTGGTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011795.1-489s1c1
Sequence:CCGGCGGCAAGTTTACATGCAACATCTCGAGATGTTGCATGTAAACTTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011795.1-625s1c1
Sequence:CCGGGCAGACCAGAACTACGACTATCTCGAGATAGTCGTAGTTCTGGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011795.1-353s1c1
Sequence:CCGGCCATCAGCACGGCCACCTATACTCGAGTATAGGTGGCCGTGCTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000446067    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011795.2-939s21c1
Sequence:CCGGTTTCCTCCGCTGAACACAAAGCTCGAGCTTTGTGTTCAGCGGAGGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000439984    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011795.2-760s21c1
Sequence:CCGGATCATCTACTCGGATTGAGCCCTCGAGGGCTCAATCCGAGTAGATGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011795.2-730s21c1
Sequence:CCGGAGCAACAAATACAGCACTTTCCTCGAGGAAAGTGCTGTATTTGTTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011795
C1QL1 MISSION shRNA Lentiviral Transduction Particles
complement component 1, q subcomponent-like 1
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000114100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011795.1-558s1c1
Sequence:CCGGCGGCACCAGTATGTGGGCAGACTCGAGTCTGCCCACATACTGGTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011795.1-489s1c1
Sequence:CCGGCGGCAAGTTTACATGCAACATCTCGAGATGTTGCATGTAAACTTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011795.1-625s1c1
Sequence:CCGGGCAGACCAGAACTACGACTATCTCGAGATAGTCGTAGTTCTGGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011795.1-353s1c1
Sequence:CCGGCCATCAGCACGGCCACCTATACTCGAGTATAGGTGGCCGTGCTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000446067    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011795.2-939s21c1
Sequence:CCGGTTTCCTCCGCTGAACACAAAGCTCGAGCTTTGTGTTCAGCGGAGGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000439984    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011795.2-760s21c1
Sequence:CCGGATCATCTACTCGGATTGAGCCCTCGAGGGCTCAATCCGAGTAGATGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011795.2-730s21c1
Sequence:CCGGAGCAACAAATACAGCACTTTCCTCGAGGAAAGTGCTGTATTTGTTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006688
C1QL1 MISSION shRNA Bacterial Glycerol Stock
complement component 1, q subcomponent-like 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000155804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006688.3-717s1c1
Sequence:CCGGCGGCAAGTTTACGTGCAACATCTCGAGATGTTGCACGTAAACTTGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155643    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006688.3-657s1c1
Sequence:CCGGCGAGGTACTCAAGTTTGACGACTCGAGTCGTCAAACTTGAGTACCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153186    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006688.3-953s1c1
Sequence:CCGGGCAACAGCAACAAATACAGCACTCGAGTGCTGTATTTGTTGCTGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006688.3-959s1c1
Sequence:CCGGGCAACAAATACAGCACGTTCTCTCGAGAGAACGTGCTGTATTTGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006688.3-913s1c1
Sequence:CCGGGAGGTCTTCATCAAGCTGGATCTCGAGATCCAGCTTGATGAAGACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006688.3-753s21c1
Sequence:CCGGTTTCACCTACCATGTCCTCATCTCGAGATGAGGACATGGTAGGTGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371529    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006688.3-683s21c1
Sequence:CCGGTCACCAACCTAGGCAACAACTCTCGAGAGTTGTTGCCTAGGTTGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371520    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006688.3-1251s21c1
Sequence:CCGGCGCTATATATTTGTACAATAGCTCGAGCTATTGTACAAATATATAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006688
C1QL1 MISSION shRNA shRNA Plasmid DNA
complement component 1, q subcomponent-like 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000155804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006688.3-717s1c1
Sequence:CCGGCGGCAAGTTTACGTGCAACATCTCGAGATGTTGCACGTAAACTTGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155643    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006688.3-657s1c1
Sequence:CCGGCGAGGTACTCAAGTTTGACGACTCGAGTCGTCAAACTTGAGTACCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153186    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006688.3-953s1c1
Sequence:CCGGGCAACAGCAACAAATACAGCACTCGAGTGCTGTATTTGTTGCTGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006688.3-959s1c1
Sequence:CCGGGCAACAAATACAGCACGTTCTCTCGAGAGAACGTGCTGTATTTGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006688.3-913s1c1
Sequence:CCGGGAGGTCTTCATCAAGCTGGATCTCGAGATCCAGCTTGATGAAGACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006688.3-753s21c1
Sequence:CCGGTTTCACCTACCATGTCCTCATCTCGAGATGAGGACATGGTAGGTGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371529    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006688.3-683s21c1
Sequence:CCGGTCACCAACCTAGGCAACAACTCTCGAGAGTTGTTGCCTAGGTTGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371520    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006688.3-1251s21c1
Sequence:CCGGCGCTATATATTTGTACAATAGCTCGAGCTATTGTACAAATATATAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006688
C1QL1 MISSION shRNA Lentiviral Transduction Particles
complement component 1, q subcomponent-like 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000155804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006688.3-717s1c1
Sequence:CCGGCGGCAAGTTTACGTGCAACATCTCGAGATGTTGCACGTAAACTTGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155643    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006688.3-657s1c1
Sequence:CCGGCGAGGTACTCAAGTTTGACGACTCGAGTCGTCAAACTTGAGTACCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153186    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006688.3-953s1c1
Sequence:CCGGGCAACAGCAACAAATACAGCACTCGAGTGCTGTATTTGTTGCTGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006688.3-959s1c1
Sequence:CCGGGCAACAAATACAGCACGTTCTCTCGAGAGAACGTGCTGTATTTGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006688.3-913s1c1
Sequence:CCGGGAGGTCTTCATCAAGCTGGATCTCGAGATCCAGCTTGATGAAGACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006688.3-753s21c1
Sequence:CCGGTTTCACCTACCATGTCCTCATCTCGAGATGAGGACATGGTAGGTGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371529    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006688.3-683s21c1
Sequence:CCGGTCACCAACCTAGGCAACAACTCTCGAGAGTTGTTGCCTAGGTTGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371520    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006688.3-1251s21c1
Sequence:CCGGCGCTATATATTTGTACAATAGCTCGAGCTATTGTACAAATATATAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks