EMAIL THIS PAGE TO A FRIEND

C1QL2

complement component 1, q subcomponent-like 2

64 Gene Product Result for
Synonyms: C1QTNF10 CTRP10
UniProtKB ID: Q7Z5L3
Gene ID:
Mouse(226359) complement component 1, q subcomponent-like 2
Rat(288979) complement component 1, q subcomponent-like 2
Zebrafish(100005110) complement component 1, q subcomponent-like 2
cow(516982) complement component 1, q subcomponent-like 2
dog(483886) complement component 1, q subcomponent-like 2
chicken(429045) complement component 1, q subcomponent-like 2
naked mole-rat(101708122) complement component 1, q subcomponent-like 2
domestic guinea pig(100712692) complement component 1, q subcomponent-like 2
sheep(101118254) complement component 1, q subcomponent-like 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_182528 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_182528 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_182528 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_207233 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_207233 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_207233 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_182528 Rosetta Predictions human pricing
NM_001105949 Rosetta Predictions rat pricing
NM_207233 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182528 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00185258 predicted 1578
2 SASI_Hs01_00185259 predicted 1133
3 SASI_Hs01_00185260 predicted 1742
4 SASI_Hs01_00185261 predicted 1455
5 SASI_Hs01_00185262 predicted 1561
6 SASI_Hs01_00185263 predicted 1455
7 SASI_Hs02_00370619 predicted 1420
8 SASI_Hs01_00185265 predicted 1166
9 SASI_Hs01_00185266 predicted 1433
10 SASI_Hs01_00185267 predicted 1738
11 SASI_Hs01_00185264 predicted 1797
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105949 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00214132 predicted 633
2 SASI_Rn02_00214133 predicted 562
3 SASI_Rn02_00214134 predicted 685
4 SASI_Rn02_00214135 predicted 296
5 SASI_Rn02_00214136 predicted 541
6 SASI_Rn02_00214137 predicted 294
7 SASI_Rn02_00214138 predicted 545
8 SASI_Rn02_00214139 predicted 565
9 SASI_Rn02_00214140 predicted 550
10 SASI_Rn02_00214141 predicted 627
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207233 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00102134 predicted 1073
2 SASI_Mm01_00102135 predicted 614
3 SASI_Mm01_00102136 predicted 1013
4 SASI_Mm01_00102137 predicted 1503
5 SASI_Mm01_00102138 predicted 1132
6 SASI_Mm01_00102140 predicted 745
7 SASI_Mm01_00102141 predicted 1462
8 SASI_Mm01_00102143 predicted 1562
9 SASI_Mm02_00351954 predicted 1270
10 SASI_Mm02_00351955 predicted 1295
11 SASI_Mm01_00102139 predicted 1533
12 SASI_Mm01_00102142 predicted 1713
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182528
C1QL2 MISSION shRNA Bacterial Glycerol Stock
complement component 1, q subcomponent-like 2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000420367    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182528.3-1746s21c1
Sequence:CCGGAGACTTTGCAAACCTGATTAGCTCGAGCTAATCAGGTTTGCAAAGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155964    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182528.1-1889s1c1
Sequence:CCGGCCTTCTTTGTGACCCGAAATACTCGAGTATTTCGGGTCACAAAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155632    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182528.1-1901s1c1
Sequence:CCGGCCCGAAATACTTGTGCAGATTCTCGAGAATCTGCACAAGTATTTCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182528.1-1104s1c1
Sequence:CCGGCCTTCTATGTGGGTCTCAAGACTCGAGTCTTGAGACCCACATAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182528.1-1459s1c1
Sequence:CCGGGTTCTCGGGCTTTCTTCTGTACTCGAGTACAGAAGAAAGCCCGAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182528.1-714s1c1
Sequence:CCGGGCATGATCTGGGAACCTTACACTCGAGTGTAAGGTTCCCAGATCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156550    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182528.1-1467s1c1
Sequence:CCGGGCTTTCTTCTGTACCCGGATTCTCGAGAATCCGGGTACAGAAGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182528
C1QL2 MISSION shRNA shRNA Plasmid DNA
complement component 1, q subcomponent-like 2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000420367    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182528.3-1746s21c1
Sequence:CCGGAGACTTTGCAAACCTGATTAGCTCGAGCTAATCAGGTTTGCAAAGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155964    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182528.1-1889s1c1
Sequence:CCGGCCTTCTTTGTGACCCGAAATACTCGAGTATTTCGGGTCACAAAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155632    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182528.1-1901s1c1
Sequence:CCGGCCCGAAATACTTGTGCAGATTCTCGAGAATCTGCACAAGTATTTCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182528.1-1104s1c1
Sequence:CCGGCCTTCTATGTGGGTCTCAAGACTCGAGTCTTGAGACCCACATAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182528.1-1459s1c1
Sequence:CCGGGTTCTCGGGCTTTCTTCTGTACTCGAGTACAGAAGAAAGCCCGAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182528.1-714s1c1
Sequence:CCGGGCATGATCTGGGAACCTTACACTCGAGTGTAAGGTTCCCAGATCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156550    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182528.1-1467s1c1
Sequence:CCGGGCTTTCTTCTGTACCCGGATTCTCGAGAATCCGGGTACAGAAGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182528
C1QL2 MISSION shRNA Lentiviral Transduction Particles
complement component 1, q subcomponent-like 2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000420367    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182528.3-1746s21c1
Sequence:CCGGAGACTTTGCAAACCTGATTAGCTCGAGCTAATCAGGTTTGCAAAGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155964    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182528.1-1889s1c1
Sequence:CCGGCCTTCTTTGTGACCCGAAATACTCGAGTATTTCGGGTCACAAAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155632    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182528.1-1901s1c1
Sequence:CCGGCCCGAAATACTTGTGCAGATTCTCGAGAATCTGCACAAGTATTTCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182528.1-1104s1c1
Sequence:CCGGCCTTCTATGTGGGTCTCAAGACTCGAGTCTTGAGACCCACATAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182528.1-1459s1c1
Sequence:CCGGGTTCTCGGGCTTTCTTCTGTACTCGAGTACAGAAGAAAGCCCGAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182528.1-714s1c1
Sequence:CCGGGCATGATCTGGGAACCTTACACTCGAGTGTAAGGTTCCCAGATCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156550    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182528.1-1467s1c1
Sequence:CCGGGCTTTCTTCTGTACCCGGATTCTCGAGAATCCGGGTACAGAAGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207233
C1QL2 MISSION shRNA Bacterial Glycerol Stock
complement component 1, q subcomponent-like 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000114091    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207233.1-1701s1c1
Sequence:CCGGCCCAGACTTGAGAAAGCTGATCTCGAGATCAGCTTTCTCAAGTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207233.1-1073s1c1
Sequence:CCGGGTGGTCACCAATCTTGGCAATCTCGAGATTGCCAAGATTGGTGACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207233.1-622s1c1
Sequence:CCGGCCGCATGATCTGTGACCCATACTCGAGTATGGGTCACAGATCATGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114093    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207233.1-1344s1c1
Sequence:CCGGGCGGCAACAATAACAAGTACACTCGAGTGTACTTGTTATTGTTGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207233.1-1000s1c1
Sequence:CCGGCGGTCCCAAGATCGCCTTCTACTCGAGTAGAAGGCGATCTTGGGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207233
C1QL2 MISSION shRNA shRNA Plasmid DNA
complement component 1, q subcomponent-like 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000114091    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207233.1-1701s1c1
Sequence:CCGGCCCAGACTTGAGAAAGCTGATCTCGAGATCAGCTTTCTCAAGTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207233.1-1073s1c1
Sequence:CCGGGTGGTCACCAATCTTGGCAATCTCGAGATTGCCAAGATTGGTGACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207233.1-622s1c1
Sequence:CCGGCCGCATGATCTGTGACCCATACTCGAGTATGGGTCACAGATCATGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114093    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207233.1-1344s1c1
Sequence:CCGGGCGGCAACAATAACAAGTACACTCGAGTGTACTTGTTATTGTTGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207233.1-1000s1c1
Sequence:CCGGCGGTCCCAAGATCGCCTTCTACTCGAGTAGAAGGCGATCTTGGGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207233
C1QL2 MISSION shRNA Lentiviral Transduction Particles
complement component 1, q subcomponent-like 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000114091    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207233.1-1701s1c1
Sequence:CCGGCCCAGACTTGAGAAAGCTGATCTCGAGATCAGCTTTCTCAAGTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207233.1-1073s1c1
Sequence:CCGGGTGGTCACCAATCTTGGCAATCTCGAGATTGCCAAGATTGGTGACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207233.1-622s1c1
Sequence:CCGGCCGCATGATCTGTGACCCATACTCGAGTATGGGTCACAGATCATGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114093    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207233.1-1344s1c1
Sequence:CCGGGCGGCAACAATAACAAGTACACTCGAGTGTACTTGTTATTGTTGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207233.1-1000s1c1
Sequence:CCGGCGGTCCCAAGATCGCCTTCTACTCGAGTAGAAGGCGATCTTGGGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks