EMAIL THIS PAGE TO A FRIEND

C1QL3

complement component 1, q subcomponent-like 3

107 Gene Product Result for
Synonyms: C1QTNF13 C1ql CTRP13 K100
UniProtKB ID: Q5VWW1, A0PJY4, A0PJY5
Gene ID:
Mouse(227580) C1q-like 3
Rat(680404) complement component 1, q subcomponent-like 3
domestic guinea pig(100721383) complement component 1, q subcomponent-like 3
naked mole-rat(101709436) complement component 1, q subcomponent-like 3
chicken(771966) complement component 1, q subcomponent-like 3
cow(614045) complement component 1, q subcomponent-like 3
domestic cat(101100731) complement component 1, q subcomponent-like 3
dog(606995) complement component 1, q subcomponent-like 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001010908 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001010908 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001010908 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_153155 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153155 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153155 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001010908 Rosetta Predictions human pricing
NM_001109403 Rosetta Predictions rat pricing
NM_153155 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001010908 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00305891 predicted 1827
2 SASI_Hs02_00305892 predicted 1857
3 SASI_Hs01_00192648 predicted 1696
4 SASI_Hs01_00192650 predicted 1992
5 SASI_Hs01_00192651 predicted 1923
6 SASI_Hs01_00192653 predicted 1721
7 SASI_Hs01_00192654 predicted 1844
8 SASI_Hs02_00305893 predicted 1964
9 SASI_Hs01_00192655 predicted 1883
10 SASI_Hs01_00192656 predicted 1904
11 SASI_Hs01_00192649 predicted 1971
12 SASI_Hs01_00192652 predicted 2003
13 SASI_Hs01_00192657 predicted 1560
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109403 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00248067 predicted 2087
2 SASI_Rn02_00248068 predicted 1638
3 SASI_Rn02_00248069 predicted 1634
4 SASI_Rn02_00248070 predicted 1595
5 SASI_Rn02_00248071 predicted 1563
6 SASI_Rn02_00248072 predicted 1418
7 SASI_Rn02_00248073 predicted 1281
8 SASI_Rn02_00248074 predicted 1598
9 SASI_Rn02_00248075 predicted 1212
10 SASI_Rn02_00248076 predicted 1306
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153155 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00088283 predicted 602
2 SASI_Mm02_00343043 predicted 519
3 SASI_Mm01_00088284 predicted 371
4 SASI_Mm01_00088285 predicted 655
5 SASI_Mm01_00088287 predicted 353
6 SASI_Mm01_00088289 predicted 677
7 SASI_Mm01_00088290 predicted 670
8 SASI_Mm01_00088291 predicted 509
9 SASI_Mm02_00343044 predicted 1160
10 SASI_Mm02_00343045 predicted 622
11 SASI_Mm01_00088286 predicted 1055
12 SASI_Mm01_00088288 predicted 1572
13 SASI_Mm01_00088292 predicted 1569
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001010908
C1QL3 MISSION shRNA Bacterial Glycerol Stock
complement component 1, q subcomponent-like 3
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000163475    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010908.1-1541s1c1
Sequence:CCGGGCAATTGCCCAAGATGCTGATCTCGAGATCAGCATCTTGGGCAATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161441    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010908.1-1447s1c1
Sequence:CCGGCATCTACTTCTTCACCTACCACTCGAGTGGTAGGTGAAGAAGTAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162502    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010908.1-1648s1c1
Sequence:CCGGCCATGGAGGAAACAACAACAACTCGAGTTGTTGTTGTTTCCTCCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158802    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001010908.1-2076s1c1
Sequence:CCGGGCTTTGGTTCTTGTGAGTTTACTCGAGTAAACTCACAAGAACCAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010908.1-1564s1c1
Sequence:CCGGGAATTACGACTATGCCAGTAACTCGAGTTACTGGCATAGTCGTAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010908.1-1660s1c1
Sequence:CCGGCAACAACAAATACAGCACGTTCTCGAGAACGTGCTGTATTTGTTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010908.1-1556s1c1
Sequence:CCGGGCTGATCAGAATTACGACTATCTCGAGATAGTCGTAATTCTGATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010908.1-1581s1c1
Sequence:CCGGGTAACAGTGTGGTTCTTCATTCTCGAGAATGAAGAACCACACTGTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163301    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010908.1-1642s1c1
Sequence:CCGGGAAAGCCCATGGAGGAAACAACTCGAGTTGTTTCCTCCATGGGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163357    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010908.1-1606s1c1
Sequence:CCGGGCCGGGAGATGAAGTCTATATCTCGAGATATAGACTTCATCTCCCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001010908
C1QL3 MISSION shRNA shRNA Plasmid DNA
complement component 1, q subcomponent-like 3
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000163475    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010908.1-1541s1c1
Sequence:CCGGGCAATTGCCCAAGATGCTGATCTCGAGATCAGCATCTTGGGCAATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161441    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010908.1-1447s1c1
Sequence:CCGGCATCTACTTCTTCACCTACCACTCGAGTGGTAGGTGAAGAAGTAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162502    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010908.1-1648s1c1
Sequence:CCGGCCATGGAGGAAACAACAACAACTCGAGTTGTTGTTGTTTCCTCCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158802    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001010908.1-2076s1c1
Sequence:CCGGGCTTTGGTTCTTGTGAGTTTACTCGAGTAAACTCACAAGAACCAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010908.1-1564s1c1
Sequence:CCGGGAATTACGACTATGCCAGTAACTCGAGTTACTGGCATAGTCGTAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010908.1-1660s1c1
Sequence:CCGGCAACAACAAATACAGCACGTTCTCGAGAACGTGCTGTATTTGTTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010908.1-1556s1c1
Sequence:CCGGGCTGATCAGAATTACGACTATCTCGAGATAGTCGTAATTCTGATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010908.1-1581s1c1
Sequence:CCGGGTAACAGTGTGGTTCTTCATTCTCGAGAATGAAGAACCACACTGTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163301    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010908.1-1642s1c1
Sequence:CCGGGAAAGCCCATGGAGGAAACAACTCGAGTTGTTTCCTCCATGGGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163357    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010908.1-1606s1c1
Sequence:CCGGGCCGGGAGATGAAGTCTATATCTCGAGATATAGACTTCATCTCCCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001010908
C1QL3 MISSION shRNA Lentiviral Transduction Particles
complement component 1, q subcomponent-like 3
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000163475    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010908.1-1541s1c1
Sequence:CCGGGCAATTGCCCAAGATGCTGATCTCGAGATCAGCATCTTGGGCAATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161441    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010908.1-1447s1c1
Sequence:CCGGCATCTACTTCTTCACCTACCACTCGAGTGGTAGGTGAAGAAGTAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162502    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010908.1-1648s1c1
Sequence:CCGGCCATGGAGGAAACAACAACAACTCGAGTTGTTGTTGTTTCCTCCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158802    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001010908.1-2076s1c1
Sequence:CCGGGCTTTGGTTCTTGTGAGTTTACTCGAGTAAACTCACAAGAACCAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010908.1-1564s1c1
Sequence:CCGGGAATTACGACTATGCCAGTAACTCGAGTTACTGGCATAGTCGTAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010908.1-1660s1c1
Sequence:CCGGCAACAACAAATACAGCACGTTCTCGAGAACGTGCTGTATTTGTTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010908.1-1556s1c1
Sequence:CCGGGCTGATCAGAATTACGACTATCTCGAGATAGTCGTAATTCTGATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010908.1-1581s1c1
Sequence:CCGGGTAACAGTGTGGTTCTTCATTCTCGAGAATGAAGAACCACACTGTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163301    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010908.1-1642s1c1
Sequence:CCGGGAAAGCCCATGGAGGAAACAACTCGAGTTGTTTCCTCCATGGGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163357    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010908.1-1606s1c1
Sequence:CCGGGCCGGGAGATGAAGTCTATATCTCGAGATATAGACTTCATCTCCCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153155
C1QL3 MISSION shRNA Bacterial Glycerol Stock
complement component 1, q subcomponent-like 3
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000114086    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153155.1-2009s1c1
Sequence:CCGGCCTGTGATCTTGCTGCTTTATCTCGAGATAAAGCAGCAAGATCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153155.1-1495s1c1
Sequence:CCGGGCTAGTGCAATTGCTCAAGATCTCGAGATCTTGAGCAATTGCACTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153155.1-1608s1c1
Sequence:CCGGCCACGGAGGAAACAACAACAACTCGAGTTGTTGTTGTTTCCTCCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153155.1-1341s1c1
Sequence:CCGGCGTGGTAACCAATCTCGGAAACTCGAGTTTCCGAGATTGGTTACCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153155.1-1634s1c1
Sequence:CCGGGCACATTCTCTGGATTTATTACTCGAGTAATAAATCCAGAGAATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153155.2-361s21c1
Sequence:CCGGCTATCAGTGCAGCCACCTATACTCGAGTATAGGTGGCTGCACTGATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416071    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153155.2-1190s21c1
Sequence:CCGGTAAGCTACTTGGAGTCTATTTCTCGAGAAATAGACTCCAAGTAGCTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422663    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153155.2-1037s21c1
Sequence:CCGGTGTGAATGAAGTCCTATATAGCTCGAGCTATATAGGACTTCATTCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424478    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153155.2-933s21c1
Sequence:CCGGTGTATCACTCAGACACATTATCTCGAGATAATGTGTCTGAGTGATACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153155
C1QL3 MISSION shRNA shRNA Plasmid DNA
complement component 1, q subcomponent-like 3
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000114086    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153155.1-2009s1c1
Sequence:CCGGCCTGTGATCTTGCTGCTTTATCTCGAGATAAAGCAGCAAGATCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153155.1-1495s1c1
Sequence:CCGGGCTAGTGCAATTGCTCAAGATCTCGAGATCTTGAGCAATTGCACTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153155.1-1608s1c1
Sequence:CCGGCCACGGAGGAAACAACAACAACTCGAGTTGTTGTTGTTTCCTCCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153155.1-1341s1c1
Sequence:CCGGCGTGGTAACCAATCTCGGAAACTCGAGTTTCCGAGATTGGTTACCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153155.1-1634s1c1
Sequence:CCGGGCACATTCTCTGGATTTATTACTCGAGTAATAAATCCAGAGAATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153155.2-361s21c1
Sequence:CCGGCTATCAGTGCAGCCACCTATACTCGAGTATAGGTGGCTGCACTGATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416071    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153155.2-1190s21c1
Sequence:CCGGTAAGCTACTTGGAGTCTATTTCTCGAGAAATAGACTCCAAGTAGCTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422663    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153155.2-1037s21c1
Sequence:CCGGTGTGAATGAAGTCCTATATAGCTCGAGCTATATAGGACTTCATTCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424478    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153155.2-933s21c1
Sequence:CCGGTGTATCACTCAGACACATTATCTCGAGATAATGTGTCTGAGTGATACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153155
C1QL3 MISSION shRNA Lentiviral Transduction Particles
complement component 1, q subcomponent-like 3
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000114086    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153155.1-2009s1c1
Sequence:CCGGCCTGTGATCTTGCTGCTTTATCTCGAGATAAAGCAGCAAGATCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153155.1-1495s1c1
Sequence:CCGGGCTAGTGCAATTGCTCAAGATCTCGAGATCTTGAGCAATTGCACTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153155.1-1608s1c1
Sequence:CCGGCCACGGAGGAAACAACAACAACTCGAGTTGTTGTTGTTTCCTCCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153155.1-1341s1c1
Sequence:CCGGCGTGGTAACCAATCTCGGAAACTCGAGTTTCCGAGATTGGTTACCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153155.1-1634s1c1
Sequence:CCGGGCACATTCTCTGGATTTATTACTCGAGTAATAAATCCAGAGAATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153155.2-361s21c1
Sequence:CCGGCTATCAGTGCAGCCACCTATACTCGAGTATAGGTGGCTGCACTGATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416071    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153155.2-1190s21c1
Sequence:CCGGTAAGCTACTTGGAGTCTATTTCTCGAGAAATAGACTCCAAGTAGCTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422663    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153155.2-1037s21c1
Sequence:CCGGTGTGAATGAAGTCCTATATAGCTCGAGCTATATAGGACTTCATTCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424478    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153155.2-933s21c1
Sequence:CCGGTGTATCACTCAGACACATTATCTCGAGATAATGTGTCTGAGTGATACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks