EMAIL THIS PAGE TO A FRIEND

C1QL4

complement component 1, q subcomponent-like 4

Synonyms: C1QTNF11 CTRP11
UniProtKB ID: Q86Z23
Gene ID:
Mouse(239659) complement component 1, q subcomponent-like 4
Rat(300220) complement component 1, q subcomponent-like 4
chicken(430993) complement component 1, q subcomponent-like 4
domestic cat(101082758) complement component 1, q subcomponent-like 4
dog(608832) complement component 1, q subcomponent-like 4
naked mole-rat(101713903) complement component 1, q subcomponent-like 4
domestic guinea pig(100726223) complement component 1, q subcomponent-like 4
sheep(101118941) complement component 1, q subcomponent-like 4
53 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001008223 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001008223 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001008223 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001024702 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001024702 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001024702 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU201381 MISSION® esiRNA esiRNA targeting mouse C1ql4 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001008223 Rosetta Predictions human pricing
XM_001063140 Rosetta Predictions rat pricing
XM_235645 Rosetta Predictions rat pricing
NM_001024702 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008223 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00034279 predicted 1565
2 SASI_Hs01_00034280 predicted 1798
3 SASI_Hs01_00034281 predicted 1589
4 SASI_Hs02_00305382 predicted 1575
5 SASI_Hs01_00034283 predicted 1075
6 SASI_Hs01_00034284 predicted 1293
7 SASI_Hs01_00034285 predicted 1159
8 SASI_Hs01_00034286 predicted 1018
9 SASI_Hs01_00034287 predicted 1292
10 SASI_Hs01_00034288 predicted 1102
11 SASI_Hs01_00034282 predicted 1751
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001063140 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00305960 predicted 863
2 SASI_Rn02_00305961 predicted 204
3 SASI_Rn02_00305962 predicted 873
4 SASI_Rn02_00305963 predicted 216
5 SASI_Rn02_00305964 predicted 891
6 SASI_Rn02_00305965 predicted 948
7 SASI_Rn02_00305966 predicted 858
8 SASI_Rn02_00305967 predicted 841
9 SASI_Rn02_00305968 predicted 674
10 SASI_Rn02_00305969 predicted 552
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_235645 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00389536 predicted 857
2 SASI_Rn02_00389537 predicted 202
3 SASI_Rn02_00389538 predicted 874
4 SASI_Rn02_00389539 predicted 209
5 SASI_Rn02_00389540 predicted 894
6 SASI_Rn02_00389541 predicted 951
7 SASI_Rn02_00389542 predicted 863
8 SASI_Rn02_00389543 predicted 842
9 SASI_Rn02_00389544 predicted 673
10 SASI_Rn02_00389545 predicted 546
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024702 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00027663 predicted 362
2 SASI_Mm01_00027664 predicted 352
3 SASI_Mm01_00027665 predicted 372
4 SASI_Mm01_00027666 predicted 452
5 SASI_Mm01_00027667 predicted 391
6 SASI_Mm01_00027668 predicted 348
7 SASI_Mm02_00287663 predicted 482
8 SASI_Mm01_00027669 predicted 346
9 SASI_Mm01_00027671 predicted 445
10 SASI_Mm01_00027672 predicted 348
11 SASI_Mm01_00027670 predicted 448
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001008223
C1QL4 MISSION shRNA Bacterial Glycerol Stock
complement component 1, q subcomponent-like 4
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434537    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008223.1-1027s21c1
Sequence:CCGGTACGTGCCTCGCATTGCTTTCCTCGAGGAAAGCAATGCGAGGCACGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008223.1-1296s21c1
Sequence:CCGGCGCCAGCAACAGCGTCATTCTCTCGAGAGAATGACGCTGTTGCTGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428800    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001008223.1-1848s21c1
Sequence:CCGGAGTGCAGGTTCTCCGTCACAACTCGAGTTGTGACGGAGAACCTGCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163882    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008223.1-1382s1c1
Sequence:CCGGCCAACAAGTACAGCACCTTCTCTCGAGAGAAGGTGCTGTACTTGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160225    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001008223.1-1816s1c1
Sequence:CCGGCATTTAGGCAAGAGAAGACATCTCGAGATGTCTTCTCTTGCCTAAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161200    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001008223.1-1786s1c1
Sequence:CCGGGCGAGGGAAATAACAGAAACACTCGAGTGTTTCTGTTATTTCCCTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189360    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008223.1-1398s1c1
Sequence:CCGGCTTCTCCGGCTTCATCATCTACTCGAGTAGATGATGAAGCCGGAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000188725    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001008223.1-1811s1c1
Sequence:CCGGGAGCCCATTTAGGCAAGAGAACTCGAGTTCTCTTGCCTAAATGGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000188983    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008223.1-1376s1c1
Sequence:CCGGGCAACACCAACAAGTACAGCACTCGAGTGCTGTACTTGTTGGTGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189361    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001008223.1-1576s1c1
Sequence:CCGGCTCTTGGTGCTCAAGGGTATACTCGAGTATACCCTTGAGCACCAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001008223
C1QL4 MISSION shRNA shRNA Plasmid DNA
complement component 1, q subcomponent-like 4
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434537    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008223.1-1027s21c1
Sequence:CCGGTACGTGCCTCGCATTGCTTTCCTCGAGGAAAGCAATGCGAGGCACGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008223.1-1296s21c1
Sequence:CCGGCGCCAGCAACAGCGTCATTCTCTCGAGAGAATGACGCTGTTGCTGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428800    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001008223.1-1848s21c1
Sequence:CCGGAGTGCAGGTTCTCCGTCACAACTCGAGTTGTGACGGAGAACCTGCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163882    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008223.1-1382s1c1
Sequence:CCGGCCAACAAGTACAGCACCTTCTCTCGAGAGAAGGTGCTGTACTTGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160225    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001008223.1-1816s1c1
Sequence:CCGGCATTTAGGCAAGAGAAGACATCTCGAGATGTCTTCTCTTGCCTAAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161200    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001008223.1-1786s1c1
Sequence:CCGGGCGAGGGAAATAACAGAAACACTCGAGTGTTTCTGTTATTTCCCTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189360    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008223.1-1398s1c1
Sequence:CCGGCTTCTCCGGCTTCATCATCTACTCGAGTAGATGATGAAGCCGGAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000188725    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001008223.1-1811s1c1
Sequence:CCGGGAGCCCATTTAGGCAAGAGAACTCGAGTTCTCTTGCCTAAATGGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000188983    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008223.1-1376s1c1
Sequence:CCGGGCAACACCAACAAGTACAGCACTCGAGTGCTGTACTTGTTGGTGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189361    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001008223.1-1576s1c1
Sequence:CCGGCTCTTGGTGCTCAAGGGTATACTCGAGTATACCCTTGAGCACCAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001008223
C1QL4 MISSION shRNA Lentiviral Transduction Particles
complement component 1, q subcomponent-like 4
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434537    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008223.1-1027s21c1
Sequence:CCGGTACGTGCCTCGCATTGCTTTCCTCGAGGAAAGCAATGCGAGGCACGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008223.1-1296s21c1
Sequence:CCGGCGCCAGCAACAGCGTCATTCTCTCGAGAGAATGACGCTGTTGCTGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428800    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001008223.1-1848s21c1
Sequence:CCGGAGTGCAGGTTCTCCGTCACAACTCGAGTTGTGACGGAGAACCTGCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163882    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008223.1-1382s1c1
Sequence:CCGGCCAACAAGTACAGCACCTTCTCTCGAGAGAAGGTGCTGTACTTGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160225    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001008223.1-1816s1c1
Sequence:CCGGCATTTAGGCAAGAGAAGACATCTCGAGATGTCTTCTCTTGCCTAAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161200    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001008223.1-1786s1c1
Sequence:CCGGGCGAGGGAAATAACAGAAACACTCGAGTGTTTCTGTTATTTCCCTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189360    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008223.1-1398s1c1
Sequence:CCGGCTTCTCCGGCTTCATCATCTACTCGAGTAGATGATGAAGCCGGAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000188725    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001008223.1-1811s1c1
Sequence:CCGGGAGCCCATTTAGGCAAGAGAACTCGAGTTCTCTTGCCTAAATGGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000188983    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008223.1-1376s1c1
Sequence:CCGGGCAACACCAACAAGTACAGCACTCGAGTGCTGTACTTGTTGGTGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189361    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001008223.1-1576s1c1
Sequence:CCGGCTCTTGGTGCTCAAGGGTATACTCGAGTATACCCTTGAGCACCAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001024702
C1QL4 MISSION shRNA Bacterial Glycerol Stock
complement component 1, q subcomponent-like 4
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000367236    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024702.1-329s21c1
Sequence:CCGGTTGCCTTCTACGCGGGTCTAACTCGAGTTAGACCCGCGTAGAAGGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367235    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024702.1-445s21c1
Sequence:CCGGCCCATGCCAGGAGTCTATTTCCTCGAGGAAATAGACTCCTGGCATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024702.1-365s21c1
Sequence:CCGGGTTATGAAGTGTTGCGCTTTGCTCGAGCAAAGCGCAACACTTCATAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024702.1-452s1c1
Sequence:CCGGCAGGAGTCTATTTCTTCGCTTCTCGAGAAGCGAAGAAATAGACTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024702.1-55s1c1
Sequence:CCGGCCAACACACTATGAGATGCTACTCGAGTAGCATCTCATAGTGTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024702.1-352s1c1
Sequence:CCGGCGGCCTCACGAGGGTTATGAACTCGAGTTCATAACCCTCGTGAGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001024702
C1QL4 MISSION shRNA shRNA Plasmid DNA
complement component 1, q subcomponent-like 4
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000367236    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024702.1-329s21c1
Sequence:CCGGTTGCCTTCTACGCGGGTCTAACTCGAGTTAGACCCGCGTAGAAGGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367235    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024702.1-445s21c1
Sequence:CCGGCCCATGCCAGGAGTCTATTTCCTCGAGGAAATAGACTCCTGGCATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024702.1-365s21c1
Sequence:CCGGGTTATGAAGTGTTGCGCTTTGCTCGAGCAAAGCGCAACACTTCATAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024702.1-452s1c1
Sequence:CCGGCAGGAGTCTATTTCTTCGCTTCTCGAGAAGCGAAGAAATAGACTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024702.1-55s1c1
Sequence:CCGGCCAACACACTATGAGATGCTACTCGAGTAGCATCTCATAGTGTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024702.1-352s1c1
Sequence:CCGGCGGCCTCACGAGGGTTATGAACTCGAGTTCATAACCCTCGTGAGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001024702
C1QL4 MISSION shRNA Lentiviral Transduction Particles
complement component 1, q subcomponent-like 4
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000367236    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024702.1-329s21c1
Sequence:CCGGTTGCCTTCTACGCGGGTCTAACTCGAGTTAGACCCGCGTAGAAGGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367235    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024702.1-445s21c1
Sequence:CCGGCCCATGCCAGGAGTCTATTTCCTCGAGGAAATAGACTCCTGGCATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024702.1-365s21c1
Sequence:CCGGGTTATGAAGTGTTGCGCTTTGCTCGAGCAAAGCGCAACACTTCATAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024702.1-452s1c1
Sequence:CCGGCAGGAGTCTATTTCTTCGCTTCTCGAGAAGCGAAGAAATAGACTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024702.1-55s1c1
Sequence:CCGGCCAACACACTATGAGATGCTACTCGAGTAGCATCTCATAGTGTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024702.1-352s1c1
Sequence:CCGGCGGCCTCACGAGGGTTATGAACTCGAGTTCATAACCCTCGTGAGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks