EMAIL THIS PAGE TO A FRIEND

C1QTNF1

C1q and tumor necrosis factor related protein 1

78 Gene Product Result for
Synonyms: CTRP1 GIP ZSIG37
UniProtKB ID: Q9BXJ1, Q96NF2, Q9GZR4
Gene ID:
Mouse(56745) C1q and tumor necrosis factor related protein 1
Rat(303701) C1q and tumor necrosis factor related protein 1
Zebrafish(550573) C1q and tumor necrosis factor related protein 1
dog(483346) C1q and tumor necrosis factor related protein 1
cow(511774) C1q and tumor necrosis factor related protein 1
domestic cat(101084329) C1q and tumor necrosis factor related protein 1
chicken(768784) C1q and tumor necrosis factor related protein 1
sheep(101122202) C1q and tumor necrosis factor related protein 1
domestic guinea pig(100726633) C1q and tumor necrosis factor related protein 1
naked mole-rat(101709442) C1q and tumor necrosis factor related protein 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_030968 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_030968 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_030968 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019959 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019959 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019959 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU062341 MISSION® esiRNA esiRNA human C1QTNF1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_030968 Rosetta Predictions human pricing
NM_198593 Rosetta Predictions human pricing
NM_198594 Rosetta Predictions human pricing
NM_001007675 Rosetta Predictions rat pricing
NM_019959 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030968 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00153335 predicted 1510
2 SASI_Hs01_00153336 predicted 823
3 SASI_Hs01_00153337 predicted 839
4 SASI_Hs01_00153338 predicted 1642
5 SASI_Hs01_00153339 predicted 823
6 SASI_Hs01_00153340 predicted 1354
7 SASI_Hs01_00153341 predicted 1635
8 SASI_Hs01_00153342 predicted 1512
9 SASI_Hs01_00153343 predicted 1146
10 SASI_Hs01_00153344 predicted 1651
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198593 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00054812 predicted 1329
2 SASI_Hs01_00054813 predicted 641
3 SASI_Hs01_00054814 predicted 659
4 SASI_Hs01_00054815 predicted 1460
5 SASI_Hs01_00054816 predicted 641
6 SASI_Hs01_00054817 predicted 1176
7 SASI_Hs01_00054818 predicted 1458
8 SASI_Hs01_00054819 predicted 1330
9 SASI_Hs01_00054820 predicted 965
10 SASI_Hs01_00054821 predicted 1474
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198594 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00101777 predicted 1344
2 SASI_Hs01_00101778 predicted 652
3 SASI_Hs01_00101779 predicted 675
4 SASI_Hs01_00101780 predicted 1468
5 SASI_Hs01_00101781 predicted 657
6 SASI_Hs01_00101782 predicted 1188
7 SASI_Hs01_00101783 predicted 1471
8 SASI_Hs01_00101784 predicted 1341
9 SASI_Hs01_00101785 predicted 979
10 SASI_Hs01_00101786 predicted 1486
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007675 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00096876 predicted 992
2 SASI_Rn01_00096877 predicted 1037
3 SASI_Rn01_00096878 predicted 359
4 SASI_Rn01_00096879 predicted 1023
5 SASI_Rn01_00096880 predicted 472
6 SASI_Rn01_00096881 predicted 1237
7 SASI_Rn01_00096882 predicted 1049
8 SASI_Rn01_00096883 predicted 774
9 SASI_Rn01_00096884 predicted 819
10 SASI_Rn01_00096885 predicted 1235
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019959 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00325256 predicted 201
2 SASI_Mm01_00036410 predicted 669
3 SASI_Mm01_00036411 predicted 516
4 SASI_Mm01_00036413 predicted 465
5 SASI_Mm02_00325257 predicted 879
6 SASI_Mm01_00036414 predicted 746
7 SASI_Mm01_00036415 predicted 608
8 SASI_Mm02_00325258 predicted 511
9 SASI_Mm02_00325259 predicted 490
10 SASI_Mm01_00036417 predicted 564
11 SASI_Mm01_00036412 predicted 841
12 SASI_Mm01_00036416 predicted 1131
13 SASI_Mm01_00036418 predicted 563
14 SASI_Mm01_00036419 predicted 953
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030968
C1QTNF1 MISSION shRNA Bacterial Glycerol Stock
C1q and tumor necrosis factor related protein 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000163892    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030968.2-874s1c1
Sequence:CCGGCAACATGTTCACCGGCAAGTTCTCGAGAACTTGCCGGTGAACATGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163674    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030968.2-856s1c1
Sequence:CCGGGAACCTCTACGACCACTTCAACTCGAGTTGAAGTGGTCGTAGAGGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160475    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030968.2-610s1c1
Sequence:CCGGCCAGATCAACATCACTATCTTCTCGAGAAGATAGTGATGTTGATCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161481    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_030968.2-1506s1c1
Sequence:CCGGGCTCCAGTCCTTGGAAATAATCTCGAGATTATTTCCAAGGACTGGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163398    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030968.2-491s1c1
Sequence:CCGGGAGAGGGCTGAAGAACAACATCTCGAGATGTTGTTCTTCAGCCCTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163611    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030968.2-664s1c1
Sequence:CCGGCCTCCAAGGGAAATATGGCAACTCGAGTTGCCATATTTCCCTTGGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371521    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030968.2-1360s21c1
Sequence:CCGGAGAGCTGACGGCAGATGAAATCTCGAGATTTCATCTGCCGTCAGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371461    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030968.2-1099s21c1
Sequence:CCGGCGAACGTGAGAACGCCATCTTCTCGAGAAGATGGCGTTCTCACGTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371460    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030968.2-1559s21c1
Sequence:CCGGAGTAAACCGTGGAGGACAAAGCTCGAGCTTTGTCCTCCACGGTTTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030968
C1QTNF1 MISSION shRNA shRNA Plasmid DNA
C1q and tumor necrosis factor related protein 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000163892    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030968.2-874s1c1
Sequence:CCGGCAACATGTTCACCGGCAAGTTCTCGAGAACTTGCCGGTGAACATGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163674    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030968.2-856s1c1
Sequence:CCGGGAACCTCTACGACCACTTCAACTCGAGTTGAAGTGGTCGTAGAGGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160475    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030968.2-610s1c1
Sequence:CCGGCCAGATCAACATCACTATCTTCTCGAGAAGATAGTGATGTTGATCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161481    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_030968.2-1506s1c1
Sequence:CCGGGCTCCAGTCCTTGGAAATAATCTCGAGATTATTTCCAAGGACTGGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163398    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030968.2-491s1c1
Sequence:CCGGGAGAGGGCTGAAGAACAACATCTCGAGATGTTGTTCTTCAGCCCTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163611    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030968.2-664s1c1
Sequence:CCGGCCTCCAAGGGAAATATGGCAACTCGAGTTGCCATATTTCCCTTGGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000371521    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030968.2-1360s21c1
Sequence:CCGGAGAGCTGACGGCAGATGAAATCTCGAGATTTCATCTGCCGTCAGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000371461    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030968.2-1099s21c1
Sequence:CCGGCGAACGTGAGAACGCCATCTTCTCGAGAAGATGGCGTTCTCACGTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000371460    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030968.2-1559s21c1
Sequence:CCGGAGTAAACCGTGGAGGACAAAGCTCGAGCTTTGTCCTCCACGGTTTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030968
C1QTNF1 MISSION shRNA Lentiviral Transduction Particles
C1q and tumor necrosis factor related protein 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000163892    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030968.2-874s1c1
Sequence:CCGGCAACATGTTCACCGGCAAGTTCTCGAGAACTTGCCGGTGAACATGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163674    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030968.2-856s1c1
Sequence:CCGGGAACCTCTACGACCACTTCAACTCGAGTTGAAGTGGTCGTAGAGGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160475    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030968.2-610s1c1
Sequence:CCGGCCAGATCAACATCACTATCTTCTCGAGAAGATAGTGATGTTGATCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161481    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_030968.2-1506s1c1
Sequence:CCGGGCTCCAGTCCTTGGAAATAATCTCGAGATTATTTCCAAGGACTGGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163398    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030968.2-491s1c1
Sequence:CCGGGAGAGGGCTGAAGAACAACATCTCGAGATGTTGTTCTTCAGCCCTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163611    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030968.2-664s1c1
Sequence:CCGGCCTCCAAGGGAAATATGGCAACTCGAGTTGCCATATTTCCCTTGGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371521    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030968.2-1360s21c1
Sequence:CCGGAGAGCTGACGGCAGATGAAATCTCGAGATTTCATCTGCCGTCAGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371461    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030968.2-1099s21c1
Sequence:CCGGCGAACGTGAGAACGCCATCTTCTCGAGAAGATGGCGTTCTCACGTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371460    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030968.2-1559s21c1
Sequence:CCGGAGTAAACCGTGGAGGACAAAGCTCGAGCTTTGTCCTCCACGGTTTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019959
C1QTNF1 MISSION shRNA Bacterial Glycerol Stock
C1q and tumor necrosis factor related protein 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000127124    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019959.1-1304s1c1
Sequence:CCGGGCAAATATCATGGGTTTCTTACTCGAGTAAGAAACCCATGATATTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019959.1-570s1c1
Sequence:CCGGGAACCTCTACAAACACTTCAACTCGAGTTGAAGTGTTTGTAGAGGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019959.1-558s1c1
Sequence:CCGGCACGGAGTTTGTGAACCTCTACTCGAGTAGAGGTTCACAAACTCCGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019959.1-585s1c1
Sequence:CCGGCTTCAATATGTTCACTGGGAACTCGAGTTCCCAGTGAACATATTGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019959.1-293s1c1
Sequence:CCGGGCACACCTGTATACCAGACAACTCGAGTTGTCTGGTATACAGGTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019959
C1QTNF1 MISSION shRNA shRNA Plasmid DNA
C1q and tumor necrosis factor related protein 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000127124    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019959.1-1304s1c1
Sequence:CCGGGCAAATATCATGGGTTTCTTACTCGAGTAAGAAACCCATGATATTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019959.1-570s1c1
Sequence:CCGGGAACCTCTACAAACACTTCAACTCGAGTTGAAGTGTTTGTAGAGGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019959.1-558s1c1
Sequence:CCGGCACGGAGTTTGTGAACCTCTACTCGAGTAGAGGTTCACAAACTCCGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019959.1-585s1c1
Sequence:CCGGCTTCAATATGTTCACTGGGAACTCGAGTTCCCAGTGAACATATTGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019959.1-293s1c1
Sequence:CCGGGCACACCTGTATACCAGACAACTCGAGTTGTCTGGTATACAGGTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019959
C1QTNF1 MISSION shRNA Lentiviral Transduction Particles
C1q and tumor necrosis factor related protein 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000127124    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019959.1-1304s1c1
Sequence:CCGGGCAAATATCATGGGTTTCTTACTCGAGTAAGAAACCCATGATATTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019959.1-570s1c1
Sequence:CCGGGAACCTCTACAAACACTTCAACTCGAGTTGAAGTGTTTGTAGAGGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019959.1-558s1c1
Sequence:CCGGCACGGAGTTTGTGAACCTCTACTCGAGTAGAGGTTCACAAACTCCGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019959.1-585s1c1
Sequence:CCGGCTTCAATATGTTCACTGGGAACTCGAGTTCCCAGTGAACATATTGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019959.1-293s1c1
Sequence:CCGGGCACACCTGTATACCAGACAACTCGAGTTGTCTGGTATACAGGTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)