EMAIL THIS PAGE TO A FRIEND

C1QTNF2

C1q and tumor necrosis factor related protein 2

64 Gene Product Result for
Synonyms: CTRP2 zacrp2
UniProtKB ID: Q9BXJ5
Gene ID:
Mouse(69183) C1q and tumor necrosis factor related protein 2
Rat(497886) C1q and tumor necrosis factor related protein 2
Zebrafish(572041) C1q and tumor necrosis factor related protein 2
dog(489149) C1q and tumor necrosis factor related protein 2
chicken(416156) C1q and tumor necrosis factor related protein 2
cow(539842) C1q and tumor necrosis factor related protein 2
domestic cat(101083486) C1q and tumor necrosis factor related protein 2
naked mole-rat(101725582) C1q and tumor necrosis factor related protein 2
domestic guinea pig(100715430) C1q and tumor necrosis factor related protein 2
sheep(101115622) C1q and tumor necrosis factor related protein 2
Domestic Rabbit(100301534) C1q and tumor necrosis factor related protein 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_031908 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_031908 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_031908 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026979 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026979 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026979 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU039761 MISSION® esiRNA esiRNA human C1QTNF2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_031908 Rosetta Predictions human pricing
XM_001067870 Rosetta Predictions rat pricing
XM_573071 Rosetta Predictions rat pricing
NM_026979 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031908 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00108143 predicted 781
2 SASI_Hs01_00108144 predicted 634
3 SASI_Hs01_00108145 predicted 866
4 SASI_Hs02_00359035 predicted 636
5 SASI_Hs01_00108146 predicted 709
6 SASI_Hs01_00108147 predicted 626
7 SASI_Hs01_00108148 predicted 863
8 SASI_Hs01_00108149 predicted 576
9 SASI_Hs01_00108150 predicted 894
10 SASI_Hs01_00108152 predicted 652
11 SASI_Hs01_00108151 predicted 897
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001067870 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00322659 predicted 640
2 SASI_Rn02_00322660 predicted 911
3 SASI_Rn02_00322661 predicted 725
4 SASI_Rn02_00322662 predicted 875
5 SASI_Rn02_00322663 predicted 876
6 SASI_Rn02_00322664 predicted 723
7 SASI_Rn02_00322665 predicted 921
8 SASI_Rn02_00322666 predicted 878
9 SASI_Rn02_00322667 predicted 616
10 SASI_Rn02_00322668 predicted 877
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_573071 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00399737 predicted 643
2 SASI_Rn02_00399738 predicted 919
3 SASI_Rn02_00399739 predicted 723
4 SASI_Rn02_00399740 predicted 877
5 SASI_Rn02_00399741 predicted 871
6 SASI_Rn02_00399742 predicted 718
7 SASI_Rn02_00399743 predicted 923
8 SASI_Rn02_00399744 predicted 881
9 SASI_Rn02_00399745 predicted 615
10 SASI_Rn02_00399746 predicted 877
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026979 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00062948 predicted 702
2 SASI_Mm01_00062949 predicted 495
3 SASI_Mm01_00062950 predicted 610
4 SASI_Mm01_00062951 predicted 283
5 SASI_Mm02_00331300 predicted 940
6 SASI_Mm02_00331301 predicted 929
7 SASI_Mm02_00331302 predicted 276
8 SASI_Mm01_00062952 predicted 721
9 SASI_Mm02_00331303 predicted 836
10 SASI_Mm01_00062954 predicted 722
11 SASI_Mm01_00062947 predicted 217
12 SASI_Mm01_00062953 predicted 230
13 SASI_Mm01_00062955 predicted 233
14 SASI_Mm01_00062956 predicted 340
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031908
C1QTNF2 MISSION shRNA Bacterial Glycerol Stock
C1q and tumor necrosis factor related protein 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166785    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031908.3-924s1c1
Sequence:CCGGCCTCTTTACGGGCTTCCTAATCTCGAGATTAGGAAGCCCGTAAAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165327    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031908.3-867s1c1
Sequence:CCGGGCAGATCTTCTACTCAGAGCACTCGAGTGCTCTGAGTAGAAGATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160991    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031908.3-870s1c1
Sequence:CCGGGATCTTCTACTCAGAGCAGAACTCGAGTTCTGCTCTGAGTAGAAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159751    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031908.3-624s1c1
Sequence:CCGGGTTTGACAAGATTCTGATGAACTCGAGTTCATCAGAATCTTGTCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160541    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031908.3-621s1c1
Sequence:CCGGCAAGTTTGACAAGATTCTGATCTCGAGATCAGAATCTTGTCAAACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161963    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031908.3-615s1c1
Sequence:CCGGGCCCATCAAGTTTGACAAGATCTCGAGATCTTGTCAAACTTGATGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162280    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_031908.3-1921s1c1
Sequence:CCGGCCGCTTCTCAATGAATGAGATCTCGAGATCTCATTCATTGAGAAGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166228    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031908.3-279s1c1
Sequence:CCGGCTCAGGAATGATGGGACGAATCTCGAGATTCGTCCCATCATTCCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165994    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031908.3-612s1c1
Sequence:CCGGGCTGCCCATCAAGTTTGACAACTCGAGTTGTCAAACTTGATGGGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031908
C1QTNF2 MISSION shRNA shRNA Plasmid DNA
C1q and tumor necrosis factor related protein 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166785    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031908.3-924s1c1
Sequence:CCGGCCTCTTTACGGGCTTCCTAATCTCGAGATTAGGAAGCCCGTAAAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165327    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031908.3-867s1c1
Sequence:CCGGGCAGATCTTCTACTCAGAGCACTCGAGTGCTCTGAGTAGAAGATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160991    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031908.3-870s1c1
Sequence:CCGGGATCTTCTACTCAGAGCAGAACTCGAGTTCTGCTCTGAGTAGAAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159751    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031908.3-624s1c1
Sequence:CCGGGTTTGACAAGATTCTGATGAACTCGAGTTCATCAGAATCTTGTCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160541    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031908.3-621s1c1
Sequence:CCGGCAAGTTTGACAAGATTCTGATCTCGAGATCAGAATCTTGTCAAACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161963    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031908.3-615s1c1
Sequence:CCGGGCCCATCAAGTTTGACAAGATCTCGAGATCTTGTCAAACTTGATGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162280    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_031908.3-1921s1c1
Sequence:CCGGCCGCTTCTCAATGAATGAGATCTCGAGATCTCATTCATTGAGAAGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166228    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031908.3-279s1c1
Sequence:CCGGCTCAGGAATGATGGGACGAATCTCGAGATTCGTCCCATCATTCCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165994    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031908.3-612s1c1
Sequence:CCGGGCTGCCCATCAAGTTTGACAACTCGAGTTGTCAAACTTGATGGGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031908
C1QTNF2 MISSION shRNA Lentiviral Transduction Particles
C1q and tumor necrosis factor related protein 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166785    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031908.3-924s1c1
Sequence:CCGGCCTCTTTACGGGCTTCCTAATCTCGAGATTAGGAAGCCCGTAAAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165327    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031908.3-867s1c1
Sequence:CCGGGCAGATCTTCTACTCAGAGCACTCGAGTGCTCTGAGTAGAAGATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160991    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031908.3-870s1c1
Sequence:CCGGGATCTTCTACTCAGAGCAGAACTCGAGTTCTGCTCTGAGTAGAAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159751    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031908.3-624s1c1
Sequence:CCGGGTTTGACAAGATTCTGATGAACTCGAGTTCATCAGAATCTTGTCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160541    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031908.3-621s1c1
Sequence:CCGGCAAGTTTGACAAGATTCTGATCTCGAGATCAGAATCTTGTCAAACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161963    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031908.3-615s1c1
Sequence:CCGGGCCCATCAAGTTTGACAAGATCTCGAGATCTTGTCAAACTTGATGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162280    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_031908.3-1921s1c1
Sequence:CCGGCCGCTTCTCAATGAATGAGATCTCGAGATCTCATTCATTGAGAAGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166228    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031908.3-279s1c1
Sequence:CCGGCTCAGGAATGATGGGACGAATCTCGAGATTCGTCCCATCATTCCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165994    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031908.3-612s1c1
Sequence:CCGGGCTGCCCATCAAGTTTGACAACTCGAGTTGTCAAACTTGATGGGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026979
C1QTNF2 MISSION shRNA Bacterial Glycerol Stock
C1q and tumor necrosis factor related protein 2
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000183979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026979.1-760s1c1
Sequence:CCGGCTATGACATTACGCTGGCCAACTCGAGTTGGCCAGCGTAATGTCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026979.1-662s1c1
Sequence:CCGGCCTATCAAGTTTGACAAGATTCTCGAGAATCTTGTCAAACTTGATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026979.1-805s1c1
Sequence:CCGGGCACAATGGTCAATACCGCATCTCGAGATGCGGTATTGACCATTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026979.1-764s1c1
Sequence:CCGGGACATTACGCTGGCCAACAAACTCGAGTTTGTTGGCCAGCGTAATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026979
C1QTNF2 MISSION shRNA shRNA Plasmid DNA
C1q and tumor necrosis factor related protein 2
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000183979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026979.1-760s1c1
Sequence:CCGGCTATGACATTACGCTGGCCAACTCGAGTTGGCCAGCGTAATGTCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026979.1-662s1c1
Sequence:CCGGCCTATCAAGTTTGACAAGATTCTCGAGAATCTTGTCAAACTTGATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026979.1-805s1c1
Sequence:CCGGGCACAATGGTCAATACCGCATCTCGAGATGCGGTATTGACCATTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026979.1-764s1c1
Sequence:CCGGGACATTACGCTGGCCAACAAACTCGAGTTTGTTGGCCAGCGTAATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026979
C1QTNF2 MISSION shRNA Lentiviral Transduction Particles
C1q and tumor necrosis factor related protein 2
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000183979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026979.1-760s1c1
Sequence:CCGGCTATGACATTACGCTGGCCAACTCGAGTTGGCCAGCGTAATGTCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026979.1-662s1c1
Sequence:CCGGCCTATCAAGTTTGACAAGATTCTCGAGAATCTTGTCAAACTTGATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026979.1-805s1c1
Sequence:CCGGGCACAATGGTCAATACCGCATCTCGAGATGCGGTATTGACCATTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026979.1-764s1c1
Sequence:CCGGGACATTACGCTGGCCAACAAACTCGAGTTTGTTGGCCAGCGTAATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks