EMAIL THIS PAGE TO A FRIEND

C1QTNF3

C1q and tumor necrosis factor related protein 3

92 Gene Product Result for
Synonyms: C1ATNF3 CORCS CORS CORS-26 CORS26 CTRP3
UniProtKB ID: Q9BXJ4, Q0VAN4, Q542Y2, Q6MZN1, Q96KY1
Gene ID:
Mouse(81799) C1q and tumor necrosis factor related protein 3
Rat(294806) C1q and tumor necrosis factor related protein 3
sheep(101113100) C1q and tumor necrosis factor related protein 3
domestic guinea pig(100715136) C1q and tumor necrosis factor related protein 3
naked mole-rat(101719490) C1q and tumor necrosis factor related protein 3
Zebrafish(553653) C1q and tumor necrosis factor related protein 3
cow(531659) C1q and tumor necrosis factor related protein 3
domestic cat(101081444) C1q and tumor necrosis factor related protein 3
dog(610959) C1q and tumor necrosis factor related protein 3
chicken(427430) C1q and tumor necrosis factor related protein 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_030888 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_030888 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_030888 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_030945 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_030945 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_030945 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU033521 MISSION® esiRNA esiRNA targeting mouse C1qtnf3 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_030945 Rosetta Predictions human pricing
NM_181435 Rosetta Predictions human pricing
NM_001134436 Rosetta Predictions rat pricing
NM_030888 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030945 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00142811 predicted 649
2 SASI_Hs01_00142812 predicted 425
3 SASI_Hs01_00142813 predicted 801
4 SASI_Hs01_00142814 predicted 606
5 SASI_Hs01_00142815 predicted 815
6 SASI_Hs02_00358526 predicted 803
7 SASI_Hs01_00142817 predicted 559
8 SASI_Hs01_00142818 predicted 498
9 SASI_Hs01_00142820 predicted 881
10 SASI_Hs02_00358527 predicted 792
11 SASI_Hs01_00142816 predicted 470
12 SASI_Hs01_00142819 predicted 704
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181435 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00232367 predicted 874
2 SASI_Hs01_00232368 predicted 639
3 SASI_Hs01_00232369 predicted 1021
4 SASI_Hs01_00232370 predicted 827
5 SASI_Hs01_00232371 predicted 1039
6 SASI_Hs02_00370051 predicted 1028
7 SASI_Hs01_00232373 predicted 774
8 SASI_Hs01_00232374 predicted 719
9 SASI_Hs01_00232376 predicted 1094
10 SASI_Hs02_00370052 predicted 1011
11 SASI_Hs01_00232372 predicted 690
12 SASI_Hs01_00232375 predicted 924
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134436 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00256339 predicted 839
2 SASI_Rn02_00256340 predicted 624
3 SASI_Rn02_00256341 predicted 659
4 SASI_Rn02_00256342 predicted 807
5 SASI_Rn02_00256343 predicted 667
6 SASI_Rn02_00256344 predicted 1052
7 SASI_Rn02_00256345 predicted 1014
8 SASI_Rn02_00256346 predicted 1028
9 SASI_Rn02_00256347 predicted 863
10 SASI_Rn02_00256348 predicted 684
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030888 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00199557 predicted 470
2 SASI_Mm01_00199558 predicted 619
3 SASI_Mm01_00199559 predicted 672
4 SASI_Mm01_00199560 predicted 743
5 SASI_Mm01_00199563 predicted 446
6 SASI_Mm02_00336963 predicted 464
7 SASI_Mm01_00199564 predicted 507
8 SASI_Mm01_00199565 predicted 316
9 SASI_Mm01_00199566 predicted 888
10 SASI_Mm02_00336964 predicted 817
11 SASI_Mm01_00199561 predicted 435
12 SASI_Mm01_00199562 predicted 490
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030888
C1QTNF3 MISSION shRNA Bacterial Glycerol Stock
C1q and tumor necrosis factor related protein 3
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000183445    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_030888.2-1711s1c1
Sequence:CCGGGCTGATATAGTACAGAAGTTACTCGAGTAACTTCTGTACTATATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179904    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_030888.2-1370s1c1
Sequence:CCGGCCCACTTACTAGACTCTACATCTCGAGATGTAGAGTCTAGTAAGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179273    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030888.2-485s1c1
Sequence:CCGGGCAATCAGAACAGTGGCATTACTCGAGTAATGCCACTGTTCTGATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216761    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030888.3-543s1c1
Sequence:CCGGGATGTCATGACTGGGAGATTTCTCGAGAAATCTCCCAGTCATGACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246739    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030888.3-485s21c1
Sequence:CCGGCAATCAGAACAGTGGCATTATCTCGAGATAATGCCACTGTTCTGATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030888.3-155s21c1
Sequence:CCGGTTGCCTGTGTCAAGATGAATACTCGAGTATTCATCTTGACACAGGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257556    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030888.3-220s21c1
Sequence:CCGGAGTGTTGCCATGGAGATTATGCTCGAGCATAATCTCCATGGCAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257572    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030888.3-627s21c1
Sequence:CCGGGAAGTGTATGTGTACCTTATGCTCGAGCATAAGGTACACATACACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030888
C1QTNF3 MISSION shRNA shRNA Plasmid DNA
C1q and tumor necrosis factor related protein 3
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000183445    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_030888.2-1711s1c1
Sequence:CCGGGCTGATATAGTACAGAAGTTACTCGAGTAACTTCTGTACTATATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179904    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_030888.2-1370s1c1
Sequence:CCGGCCCACTTACTAGACTCTACATCTCGAGATGTAGAGTCTAGTAAGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179273    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030888.2-485s1c1
Sequence:CCGGGCAATCAGAACAGTGGCATTACTCGAGTAATGCCACTGTTCTGATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216761    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030888.3-543s1c1
Sequence:CCGGGATGTCATGACTGGGAGATTTCTCGAGAAATCTCCCAGTCATGACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246739    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030888.3-485s21c1
Sequence:CCGGCAATCAGAACAGTGGCATTATCTCGAGATAATGCCACTGTTCTGATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030888.3-155s21c1
Sequence:CCGGTTGCCTGTGTCAAGATGAATACTCGAGTATTCATCTTGACACAGGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257556    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030888.3-220s21c1
Sequence:CCGGAGTGTTGCCATGGAGATTATGCTCGAGCATAATCTCCATGGCAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257572    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030888.3-627s21c1
Sequence:CCGGGAAGTGTATGTGTACCTTATGCTCGAGCATAAGGTACACATACACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030888
C1QTNF3 MISSION shRNA Lentiviral Transduction Particles
C1q and tumor necrosis factor related protein 3
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000183445    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_030888.2-1711s1c1
Sequence:CCGGGCTGATATAGTACAGAAGTTACTCGAGTAACTTCTGTACTATATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179904    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_030888.2-1370s1c1
Sequence:CCGGCCCACTTACTAGACTCTACATCTCGAGATGTAGAGTCTAGTAAGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179273    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030888.2-485s1c1
Sequence:CCGGGCAATCAGAACAGTGGCATTACTCGAGTAATGCCACTGTTCTGATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216761    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030888.3-543s1c1
Sequence:CCGGGATGTCATGACTGGGAGATTTCTCGAGAAATCTCCCAGTCATGACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246739    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030888.3-485s21c1
Sequence:CCGGCAATCAGAACAGTGGCATTATCTCGAGATAATGCCACTGTTCTGATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030888.3-155s21c1
Sequence:CCGGTTGCCTGTGTCAAGATGAATACTCGAGTATTCATCTTGACACAGGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257556    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030888.3-220s21c1
Sequence:CCGGAGTGTTGCCATGGAGATTATGCTCGAGCATAATCTCCATGGCAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257572    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030888.3-627s21c1
Sequence:CCGGGAAGTGTATGTGTACCTTATGCTCGAGCATAAGGTACACATACACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030945
C1QTNF3 MISSION shRNA Bacterial Glycerol Stock
C1q and tumor necrosis factor related protein 3
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000143783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030945.1-202s1c1
Sequence:CCGGGTAAGTGTTGTCATGGAGACTCTCGAGAGTCTCCATGACAACACTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030945.1-213s1c1
Sequence:CCGGCATGGAGACTACAGCTTTCGACTCGAGTCGAAAGCTGTAGTCTCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030945.1-641s1c1
Sequence:CCGGCAACACAGTCTTCAGCATGTACTCGAGTACATGCTGAAGACTGTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142944    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030945.1-276s1c1
Sequence:CCGGCCAGGAAACCATGGAAACAATCTCGAGATTGTTTCCATGGTTTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030945.1-142s1c1
Sequence:CCGGGCCTGTGTCAAGATGAATACACTCGAGTGTATTCATCTTGACACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143557    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030945.1-156s1c1
Sequence:CCGGGAATACATGGAGTCTCCACAACTCGAGTTGTGGAGACTCCATGTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030945.1-150s1c1
Sequence:CCGGCAAGATGAATACATGGAGTCTCTCGAGAGACTCCATGTATTCATCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371572    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030945.2-616s21c1
Sequence:CCGGGAAGTGTATGTGTACCTTATGCTCGAGCATAAGGTACACATACACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371462    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030945.2-1027s21c1
Sequence:CCGGTCAGATGACCTTGACTAATATCTCGAGATATTAGTCAAGGTCATCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371523    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030945.2-1283s21c1
Sequence:CCGGGCTGCCTTATTAGCTAATTTACTCGAGTAAATTAGCTAATAAGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030945
C1QTNF3 MISSION shRNA shRNA Plasmid DNA
C1q and tumor necrosis factor related protein 3
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000143783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030945.1-202s1c1
Sequence:CCGGGTAAGTGTTGTCATGGAGACTCTCGAGAGTCTCCATGACAACACTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030945.1-213s1c1
Sequence:CCGGCATGGAGACTACAGCTTTCGACTCGAGTCGAAAGCTGTAGTCTCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030945.1-641s1c1
Sequence:CCGGCAACACAGTCTTCAGCATGTACTCGAGTACATGCTGAAGACTGTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142944    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030945.1-276s1c1
Sequence:CCGGCCAGGAAACCATGGAAACAATCTCGAGATTGTTTCCATGGTTTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030945.1-142s1c1
Sequence:CCGGGCCTGTGTCAAGATGAATACACTCGAGTGTATTCATCTTGACACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143557    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030945.1-156s1c1
Sequence:CCGGGAATACATGGAGTCTCCACAACTCGAGTTGTGGAGACTCCATGTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030945.1-150s1c1
Sequence:CCGGCAAGATGAATACATGGAGTCTCTCGAGAGACTCCATGTATTCATCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371572    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030945.2-616s21c1
Sequence:CCGGGAAGTGTATGTGTACCTTATGCTCGAGCATAAGGTACACATACACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371462    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030945.2-1027s21c1
Sequence:CCGGTCAGATGACCTTGACTAATATCTCGAGATATTAGTCAAGGTCATCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371523    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030945.2-1283s21c1
Sequence:CCGGGCTGCCTTATTAGCTAATTTACTCGAGTAAATTAGCTAATAAGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030945
C1QTNF3 MISSION shRNA Lentiviral Transduction Particles
C1q and tumor necrosis factor related protein 3
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000143783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030945.1-202s1c1
Sequence:CCGGGTAAGTGTTGTCATGGAGACTCTCGAGAGTCTCCATGACAACACTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030945.1-213s1c1
Sequence:CCGGCATGGAGACTACAGCTTTCGACTCGAGTCGAAAGCTGTAGTCTCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030945.1-641s1c1
Sequence:CCGGCAACACAGTCTTCAGCATGTACTCGAGTACATGCTGAAGACTGTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142944    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030945.1-276s1c1
Sequence:CCGGCCAGGAAACCATGGAAACAATCTCGAGATTGTTTCCATGGTTTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030945.1-142s1c1
Sequence:CCGGGCCTGTGTCAAGATGAATACACTCGAGTGTATTCATCTTGACACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143557    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030945.1-156s1c1
Sequence:CCGGGAATACATGGAGTCTCCACAACTCGAGTTGTGGAGACTCCATGTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030945.1-150s1c1
Sequence:CCGGCAAGATGAATACATGGAGTCTCTCGAGAGACTCCATGTATTCATCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371572    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030945.2-616s21c1
Sequence:CCGGGAAGTGTATGTGTACCTTATGCTCGAGCATAAGGTACACATACACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371462    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030945.2-1027s21c1
Sequence:CCGGTCAGATGACCTTGACTAATATCTCGAGATATTAGTCAAGGTCATCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371523    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030945.2-1283s21c1
Sequence:CCGGGCTGCCTTATTAGCTAATTTACTCGAGTAAATTAGCTAATAAGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks