EMAIL THIS PAGE TO A FRIEND

C1QTNF4

C1q and tumor necrosis factor related protein 4

52 Gene Product Result for
Synonyms: CTRP4 ZACRP4
UniProtKB ID: Q9BXJ3, Q8IV25
Gene ID:
Mouse(67445) C1q and tumor necrosis factor related protein 4
Rat(311184) C1q and tumor necrosis factor related protein 4
Zebrafish(550397) C1q and tumor necrosis factor related protein 4
chicken(428863) C1q and tumor necrosis factor related protein 4
dog(483620) C1q and tumor necrosis factor related protein 4
cow(617462) C1q and tumor necrosis factor related protein 4
naked mole-rat(101697002) C1q and tumor necrosis factor related protein 4
domestic guinea pig(100728780) C1q and tumor necrosis factor related protein 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1293 Human C1qTNF4 ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026161 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026161 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026161 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_031909 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_031909 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_031909 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_031909 Rosetta Predictions human pricing
NM_001107745 Rosetta Predictions rat pricing
NM_026161 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031909 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00164674 predicted 531
2 SASI_Hs01_00164676 predicted 516
3 SASI_Hs01_00164677 predicted 326
4 SASI_Hs02_00359036 predicted 406
5 SASI_Hs01_00164678 predicted 530
6 SASI_Hs01_00164679 predicted 516
7 SASI_Hs01_00164680 predicted 475
8 SASI_Hs01_00164681 predicted 479
9 SASI_Hs01_00164682 predicted 474
10 SASI_Hs01_00164683 predicted 515
11 SASI_Hs01_00164675 predicted 362
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107745 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00231855 predicted 1089
2 SASI_Rn02_00231856 predicted 463
3 SASI_Rn02_00231857 predicted 566
4 SASI_Rn02_00231858 predicted 480
5 SASI_Rn02_00231859 predicted 918
6 SASI_Rn02_00231860 predicted 878
7 SASI_Rn02_00231861 predicted 1067
8 SASI_Rn02_00231862 predicted 921
9 SASI_Rn02_00231863 predicted 1055
10 SASI_Rn02_00231864 predicted 463
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026161 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00114901 predicted 1102
2 SASI_Mm02_00329783 predicted 467
3 SASI_Mm02_00329784 predicted 354
4 SASI_Mm02_00329785 predicted 1018
5 SASI_Mm02_00329786 predicted 472
6 SASI_Mm01_00114904 predicted 1107
7 SASI_Mm01_00114906 predicted 1139
8 SASI_Mm01_00114907 predicted 1062
9 SASI_Mm01_00114908 predicted 1087
10 SASI_Mm02_00329787 predicted 475
11 SASI_Mm01_00114900 predicted 754
12 SASI_Mm01_00114902 predicted 748
13 SASI_Mm01_00114903 predicted 862
14 SASI_Mm01_00114905 predicted 861
15 SASI_Mm01_00114909 predicted 935
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026161
C1QTNF4 MISSION shRNA Bacterial Glycerol Stock
C1q and tumor necrosis factor related protein 4
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000425949    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026161.3-478s21c1
Sequence:CCGGGCACAAGAGCCTGTCGGTGATCTCGAGATCACCGACAGGCTCTTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422611    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026161.3-824s21c1
Sequence:CCGGTTCGACACCGAGCTGGTAAACCTCGAGGTTTACCAGCTCGGTGTCGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026161.1-1042s1c1
Sequence:CCGGCACGGCAAGTACATCACTTTCCTCGAGGAAAGTGATGTACTTGCCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026161.1-828s1c1
Sequence:CCGGCTATTTCTTCTCCTTCACGCTCTCGAGAGCGTGAAGGAGAAGAAATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026161.1-1044s1c1
Sequence:CCGGCGGCAAGTACATCACTTTCTCCTCGAGGAGAAAGTGATGTACTTGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026161.1-1000s1c1
Sequence:CCGGCTACTTAGCCACGATCACGATCTCGAGATCGTGATCGTGGCTAAGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026161.1-1050s1c1
Sequence:CCGGGTACATCACTTTCTCAGGCTTCTCGAGAAGCCTGAGAAAGTGATGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026161
C1QTNF4 MISSION shRNA shRNA Plasmid DNA
C1q and tumor necrosis factor related protein 4
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000425949    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026161.3-478s21c1
Sequence:CCGGGCACAAGAGCCTGTCGGTGATCTCGAGATCACCGACAGGCTCTTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422611    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026161.3-824s21c1
Sequence:CCGGTTCGACACCGAGCTGGTAAACCTCGAGGTTTACCAGCTCGGTGTCGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026161.1-1042s1c1
Sequence:CCGGCACGGCAAGTACATCACTTTCCTCGAGGAAAGTGATGTACTTGCCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026161.1-828s1c1
Sequence:CCGGCTATTTCTTCTCCTTCACGCTCTCGAGAGCGTGAAGGAGAAGAAATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026161.1-1044s1c1
Sequence:CCGGCGGCAAGTACATCACTTTCTCCTCGAGGAGAAAGTGATGTACTTGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026161.1-1000s1c1
Sequence:CCGGCTACTTAGCCACGATCACGATCTCGAGATCGTGATCGTGGCTAAGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026161.1-1050s1c1
Sequence:CCGGGTACATCACTTTCTCAGGCTTCTCGAGAAGCCTGAGAAAGTGATGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026161
C1QTNF4 MISSION shRNA Lentiviral Transduction Particles
C1q and tumor necrosis factor related protein 4
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000425949    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026161.3-478s21c1
Sequence:CCGGGCACAAGAGCCTGTCGGTGATCTCGAGATCACCGACAGGCTCTTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422611    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026161.3-824s21c1
Sequence:CCGGTTCGACACCGAGCTGGTAAACCTCGAGGTTTACCAGCTCGGTGTCGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026161.1-1042s1c1
Sequence:CCGGCACGGCAAGTACATCACTTTCCTCGAGGAAAGTGATGTACTTGCCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026161.1-828s1c1
Sequence:CCGGCTATTTCTTCTCCTTCACGCTCTCGAGAGCGTGAAGGAGAAGAAATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026161.1-1044s1c1
Sequence:CCGGCGGCAAGTACATCACTTTCTCCTCGAGGAGAAAGTGATGTACTTGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026161.1-1000s1c1
Sequence:CCGGCTACTTAGCCACGATCACGATCTCGAGATCGTGATCGTGGCTAAGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026161.1-1050s1c1
Sequence:CCGGGTACATCACTTTCTCAGGCTTCTCGAGAAGCCTGAGAAAGTGATGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031909
C1QTNF4 MISSION shRNA Bacterial Glycerol Stock
C1q and tumor necrosis factor related protein 4
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000243379    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031909.2-717s21c1
Sequence:CCGGCTTCAGCGGCTACCTAGTCTACTCGAGTAGACTAGGTAGCCGCTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243381    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031909.2-416s21c1
Sequence:CCGGTCGACAAGGTGTACGTGAACACTCGAGTGTTCACGTACACCTTGTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243382    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031909.2-984s21c1
Sequence:CCGGGCGTAAGACGCTGTCGGTTAACTCGAGTTAACCGACAGCGTCTTACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243378    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031909.2-878s21c1
Sequence:CCGGACACCGAGTTCGTCAACATTGCTCGAGCAATGTTGACGAACTCGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243380    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031909.2-1023s21c1
Sequence:CCGGCGAGGTGCAGGCCATGATTTACTCGAGTAAATCATGGCCTGCACCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180112    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031909.1-374s1c1
Sequence:CCGGCGACAAGGTGTACGTGAACATCTCGAGATGTTCACGTACACCTTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031909
C1QTNF4 MISSION shRNA shRNA Plasmid DNA
C1q and tumor necrosis factor related protein 4
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000243379    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031909.2-717s21c1
Sequence:CCGGCTTCAGCGGCTACCTAGTCTACTCGAGTAGACTAGGTAGCCGCTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243381    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031909.2-416s21c1
Sequence:CCGGTCGACAAGGTGTACGTGAACACTCGAGTGTTCACGTACACCTTGTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243382    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031909.2-984s21c1
Sequence:CCGGGCGTAAGACGCTGTCGGTTAACTCGAGTTAACCGACAGCGTCTTACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243378    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031909.2-878s21c1
Sequence:CCGGACACCGAGTTCGTCAACATTGCTCGAGCAATGTTGACGAACTCGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243380    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031909.2-1023s21c1
Sequence:CCGGCGAGGTGCAGGCCATGATTTACTCGAGTAAATCATGGCCTGCACCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180112    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031909.1-374s1c1
Sequence:CCGGCGACAAGGTGTACGTGAACATCTCGAGATGTTCACGTACACCTTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031909
C1QTNF4 MISSION shRNA Lentiviral Transduction Particles
C1q and tumor necrosis factor related protein 4
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000243379    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031909.2-717s21c1
Sequence:CCGGCTTCAGCGGCTACCTAGTCTACTCGAGTAGACTAGGTAGCCGCTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243381    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031909.2-416s21c1
Sequence:CCGGTCGACAAGGTGTACGTGAACACTCGAGTGTTCACGTACACCTTGTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243382    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031909.2-984s21c1
Sequence:CCGGGCGTAAGACGCTGTCGGTTAACTCGAGTTAACCGACAGCGTCTTACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243378    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031909.2-878s21c1
Sequence:CCGGACACCGAGTTCGTCAACATTGCTCGAGCAATGTTGACGAACTCGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243380    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031909.2-1023s21c1
Sequence:CCGGCGAGGTGCAGGCCATGATTTACTCGAGTAAATCATGGCCTGCACCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180112    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031909.1-374s1c1
Sequence:CCGGCGACAAGGTGTACGTGAACATCTCGAGATGTTCACGTACACCTTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks